diff --git a/.github/max-lines-ignore b/.github/max-lines-ignore index aeb750a24b..984dbe6eae 100644 --- a/.github/max-lines-ignore +++ b/.github/max-lines-ignore @@ -16,6 +16,7 @@ docling/backend/html_backend.py docling/backend/msexcel_backend.py docling/backend/mspowerpoint_backend.py docling/backend/msword_backend.py +docling/backend/xml/jats_backend.py docling/backend/xml/uspto_backend.py docling/backend/opendocument_backend.py docling/datamodel/pipeline_options.py @@ -29,4 +30,5 @@ tests/test_service_client_sdk_unit.py tests/test_backend_opendocument.py tests/test_backend_html.py tests/test_backend_msword.py +tests/test_backend_jats.py tests/test_cli.py \ No newline at end of file diff --git a/docling/backend/msword_backend.py b/docling/backend/msword_backend.py index 6a47bed406..ca82958563 100644 --- a/docling/backend/msword_backend.py +++ b/docling/backend/msword_backend.py @@ -22,6 +22,7 @@ DocItemLabel, DoclingDocument, DocumentOrigin, + GroupItem, GroupLabel, ImageRef, ListGroup, @@ -2669,9 +2670,14 @@ def _create_or_reuse_parent( prev_parent: NodeItem | None, paragraph_elements: list, ) -> NodeItem | None: + has_script = any( + fmt is not None + and getattr(fmt, "script", Script.BASELINE) != Script.BASELINE + for _, fmt, _ in paragraph_elements + ) return ( doc.add_inline_group(parent=prev_parent, content_layer=self.content_layer) - if len(paragraph_elements) > 1 + if (len(paragraph_elements) > 1 or has_script) else prev_parent ) @@ -3452,13 +3458,45 @@ def _group_cell_elements( parent=docling_table, content_layer=content_layer, ) + seen_parents: set[str] = set() for prov in provs_in_cell: - group_element.children.append(prov) pr_item = prov.resolve(doc) - item_parent = pr_item.parent.resolve(doc) - if pr_item.get_ref() in item_parent.children: - item_parent.children.remove(pr_item.get_ref()) - pr_item.parent = group_element.get_ref() + item_parent = pr_item.parent.resolve(doc) if pr_item.parent else None + if ( + item_parent is not None + and isinstance(item_parent, GroupItem) + and item_parent.label == GroupLabel.INLINE + ): + if item_parent.self_ref not in seen_parents: + seen_parents.add(item_parent.self_ref) + old_grandparent = ( + item_parent.parent.resolve(doc) if item_parent.parent else None + ) + if ( + old_grandparent + and item_parent.get_ref() in old_grandparent.children + ): + old_grandparent.children.remove(item_parent.get_ref()) + item_parent.parent = group_element.get_ref() + group_element.children.append(item_parent.get_ref()) + else: + if ( + isinstance(pr_item, TextItem) + and pr_item.formatting + and pr_item.formatting.script in (Script.SUB, Script.SUPER) + ): + if item_parent and pr_item.get_ref() in item_parent.children: + item_parent.children.remove(pr_item.get_ref()) + inline_group = doc.add_inline_group( + parent=group_element, content_layer=content_layer + ) + pr_item.parent = inline_group.get_ref() + inline_group.children.append(pr_item.get_ref()) + else: + if item_parent and pr_item.get_ref() in item_parent.children: + item_parent.children.remove(pr_item.get_ref()) + pr_item.parent = group_element.get_ref() + group_element.children.append(prov) ref_for_rich_cell = group_element.get_ref() return ref_for_rich_cell @@ -3689,10 +3727,11 @@ def _is_rich_table_cell(self, cell: _Cell) -> bool: # paragraph must contain runs with no run-properties for para in paragraphs: runs = list(para.iterchildren(f"{_W_NS_CLARK}r")) + para_obj = Paragraph(para, self.docx_obj) for rn in runs: - item: Run = Run(rn, self.docx_obj) + item: Run = Run(rn, para_obj) if item is not None: - fm = MsWordDocumentBackend._get_format_from_run(item) + fm = MsWordDocumentBackend._get_format_from_run(item, para_obj) if fm != Formatting(): return True diff --git a/docling/backend/opendocument_backend.py b/docling/backend/opendocument_backend.py index 6932f04639..0b17a7ebe0 100644 --- a/docling/backend/opendocument_backend.py +++ b/docling/backend/opendocument_backend.py @@ -901,7 +901,7 @@ def _odf_cell_has_rich_content(cell: Any) -> bool: elif isinstance(child, Paragraph): if _clean_odf_text_lines(child.text_recursive): non_empty_paragraphs += 1 - if child.get_images(): + if child.get_images() or child.get_elements("text:span | text:a"): return True elif isinstance(child, OdfTable): if _odf_table_has_content(child): diff --git a/docling/backend/xml/jats_backend.py b/docling/backend/xml/jats_backend.py index 7d6a174860..5b51399526 100644 --- a/docling/backend/xml/jats_backend.py +++ b/docling/backend/xml/jats_backend.py @@ -38,8 +38,10 @@ GroupLabel, ImageRef, NodeItem, + RichTableCell, TableCell, TableData, + TableItem, TextItem, ) from docling_core.types.doc.document import Formatting, Script @@ -98,8 +100,12 @@ _JATS_FORMAT_TAG_MAP: Final[dict[str, dict[str, bool | Script]]] = { "bold": {"bold": True}, "italic": {"italic": True}, + "b": {"bold": True}, + "i": {"italic": True}, "underline": {"underline": True}, + "u": {"underline": True}, "strike": {"strikethrough": True}, + "s": {"strikethrough": True}, "sub": {"script": Script.SUB}, "sup": {"script": Script.SUPER}, } @@ -239,12 +245,13 @@ def __init__( ): self.valid = True return - for ent in doc_info.internalDTD.iterentities(): - if ent.system_url and any( - kwd in ent.system_url for kwd in JATS_DTD_URL - ): - self.valid = True - return + if doc_info.internalDTD is not None: + for ent in doc_info.internalDTD.iterentities(): + if ent.system_url and any( + kwd in ent.system_url for kwd in JATS_DTD_URL + ): + self.valid = True + return except Exception as exc: raise DocumentLoadError( f"Could not initialize JATS backend for file with hash {self.document_hash}." @@ -900,7 +907,16 @@ def _emit_inline( segments = JatsDocumentBackend._strip_segments(segments) if not segments: return - container = doc.add_inline_group(parent=parent) if len(segments) > 1 else parent + has_script = any( + s.formatting is not None + and getattr(s.formatting, "script", Script.BASELINE) != Script.BASELINE + for s in segments + ) + container = ( + doc.add_inline_group(parent=parent) + if (len(segments) > 1 or has_script) + else parent + ) for segment in segments: doc.add_text( label=segment.label, @@ -1031,8 +1047,43 @@ def _add_metadata( return @staticmethod - def parse_table_data(element: Tag) -> TableData | None: - # TODO, see how to implement proper support for rich tables from HTML backend + def _walk_soup_cell( + cell: Tag, + formatting: Formatting | None = None, + hyperlink: AnyUrl | Path | None = None, + ) -> list[InlineSegment]: + from bs4 import NavigableString + + segments: list[InlineSegment] = [] + for child in cell.children: + if isinstance(child, NavigableString): + text = str(child) + if text: + JatsDocumentBackend._append_run( + segments, text, formatting, hyperlink + ) + elif isinstance(child, Tag): + current_fmt = JatsDocumentBackend._merge_formatting( + formatting, child.name + ) + current_href = hyperlink + if child.name in ("ext-link", "a"): + href = child.get("xlink:href") or child.get("href") + if href: + current_href = JatsDocumentBackend._parse_ext_link_href(href) + segments.extend( + JatsDocumentBackend._walk_soup_cell( + child, current_fmt, current_href + ) + ) + return segments + + @staticmethod + def parse_table_data( + element: Tag, + doc: DoclingDocument | None = None, + table_item: TableItem | None = None, + ) -> TableData | None: nested_tables = element.find("table") if nested_tables is not None: _log.debug("Skipping nested table.") @@ -1124,17 +1175,44 @@ def parse_table_data(element: Tag) -> TableData | None: if row_idx + r < num_rows and col_idx + c < num_cols: grid[row_idx + r][col_idx + c] = text - table_cell = TableCell( - text=text, - row_span=row_span, - col_span=col_span, - start_row_offset_idx=start_row_span + row_idx, - end_row_offset_idx=start_row_span + row_idx + row_span, - start_col_offset_idx=col_idx, - end_col_offset_idx=col_idx + col_span, - column_header=col_header, - row_header=((not col_header) and html_cell.name == "th"), + segments = JatsDocumentBackend._walk_soup_cell(html_cell) + has_rich = any( + s.formatting is not None + and getattr(s.formatting, "script", Script.BASELINE) + != Script.BASELINE + for s in segments ) + if has_rich and doc is not None and table_item is not None: + group = doc.add_group( + label=GroupLabel.UNSPECIFIED, + name=f"rich_cell_group_{len(doc.tables)}_{col_idx}_{start_row_span + row_idx}", + parent=table_item, + ) + JatsDocumentBackend._emit_inline(doc, group, segments) + table_cell = RichTableCell( + text=text, + row_span=row_span, + col_span=col_span, + start_row_offset_idx=start_row_span + row_idx, + end_row_offset_idx=start_row_span + row_idx + row_span, + start_col_offset_idx=col_idx, + end_col_offset_idx=col_idx + col_span, + column_header=col_header, + row_header=((not col_header) and html_cell.name == "th"), + ref=group.get_ref(), + ) + else: + table_cell = TableCell( + text=text, + row_span=row_span, + col_span=col_span, + start_row_offset_idx=start_row_span + row_idx, + end_row_offset_idx=start_row_span + row_idx + row_span, + start_col_offset_idx=col_idx, + end_col_offset_idx=col_idx + col_span, + column_header=col_header, + row_header=((not col_header) and html_cell.name == "th"), + ) data.table_cells.append(table_cell) return data @@ -1147,8 +1225,6 @@ def _add_table( if not isinstance(table_tag, Tag): return - data = JatsDocumentBackend.parse_table_data(table_tag) - # TODO: format label vs caption once styling is supported label = table_xml_component["label"] caption = table_xml_component["caption"] table_text: str = f"{label}{' ' if label and caption else ''}{caption}" @@ -1157,8 +1233,18 @@ def _add_table( if table_text else None ) + table_item = doc.add_table( + data=TableData(num_rows=0, num_cols=0, table_cells=[]), + parent=parent, + caption=table_caption, + ) + data = JatsDocumentBackend.parse_table_data( + table_tag, doc=doc, table_item=table_item + ) if data is not None: - doc.add_table(data=data, parent=parent, caption=table_caption) + table_item.data = data + else: + doc.delete_items(node_items=[table_item]) return diff --git a/docling/utils/chandra_utils.py b/docling/utils/chandra_utils.py index 9381ee7d39..b65bdf97d7 100644 --- a/docling/utils/chandra_utils.py +++ b/docling/utils/chandra_utils.py @@ -426,7 +426,10 @@ def _emit_runs( else: # An equation block mixing prose and inline math is text, not one formula. label = DocItemLabel.TEXT - if len(merged) > 1: + if len(merged) > 1 or any( + run.formatting and run.formatting.script in (Script.SUB, Script.SUPER) + for run in merged + ): if label != DocItemLabel.TEXT: parent = self.doc.add_text( label=label, diff --git a/tests/data/docx/groundtruth/docx_rich_cells.docx.html b/tests/data/docx/groundtruth/docx_rich_cells.docx.html index be69ab91e7..1e9431aaae 100644 --- a/tests/data/docx/groundtruth/docx_rich_cells.docx.html +++ b/tests/data/docx/groundtruth/docx_rich_cells.docx.html @@ -196,26 +196,12 @@

Table with rich cells

  • Number one
  • Number two
  • Number three
    • -

    This is simple text with

    -

    bold

     -

    ,

    -

    strikethrough

     -

    and

    -

    italic

     -

    formatting with x

    -

    2

     -

    and H

    -

    2

     -

    O

    This is a paragraph

    +This is simple text with bold , strikethrough and italic formatting with x 2 and H 2 O

    This is a paragraph

    This is another paragraph

    Table with nested table

    Before table

    -
    Column AColumn B
    Simple cell upper left

    Simple cell with

    -

    bold

     -

    and

    -

    italic

     -

    text

    ABC

    Cell 1

    Cell 2

    Cell 3

    +
    Column AColumn B
    Simple cell upper leftSimple cell with bold and italic text
    ABC

    Cell 1

    Cell 2

    Cell 3

    Rich cell
    A nested table

    ABC

    Cell 1

    Cell 2

    Cell 3

    diff --git a/tests/data/docx/groundtruth/docx_rich_cells.docx.itxt b/tests/data/docx/groundtruth/docx_rich_cells.docx.itxt index 406fe7873f..ea2f3ce780 100644 --- a/tests/data/docx/groundtruth/docx_rich_cells.docx.itxt +++ b/tests/data/docx/groundtruth/docx_rich_cells.docx.itxt @@ -34,52 +34,52 @@ Second Paragraph item-31 at level 7: list_item: Number two item-32 at level 7: list_item: Number three item-33 at level 5: unspecified: group rich_cell_group_1_1_2 - item-34 at level 6: text: This is simple text with - item-35 at level 6: text: bold - item-36 at level 6: text: , - item-37 at level 6: text: strikethrough - item-38 at level 6: text: and - item-39 at level 6: text: italic - item-40 at level 6: text: formatting with x - item-41 at level 6: text: 2 - item-42 at level 6: text: and H - item-43 at level 6: text: 2 - item-44 at level 6: text: O - item-45 at level 5: unspecified: group rich_cell_group_1_0_3 - item-46 at level 6: text: This is a paragraph - item-47 at level 6: text: This is another paragraph - item-48 at level 4: inline: group group + item-34 at level 6: inline: group group + item-35 at level 7: text: This is simple text with + item-36 at level 7: text: bold + item-37 at level 7: text: , + item-38 at level 7: text: strikethrough + item-39 at level 7: text: and + item-40 at level 7: text: italic + item-41 at level 7: text: formatting with x + item-42 at level 7: text: 2 + item-43 at level 7: text: and H + item-44 at level 7: text: 2 + item-45 at level 7: text: O + item-46 at level 5: unspecified: group rich_cell_group_1_0_3 + item-47 at level 6: text: This is a paragraph + item-48 at level 6: text: This is another paragraph item-49 at level 4: text: item-50 at level 3: section_header: Table with nested table item-51 at level 4: text: Before table item-52 at level 4: table with [3x2] item-53 at level 5: unspecified: group rich_cell_group_2_1_1 - item-54 at level 6: text: Simple cell with - item-55 at level 6: text: bold - item-56 at level 6: text: and - item-57 at level 6: text: italic - item-58 at level 6: text: text - item-59 at level 5: unspecified: group rich_cell_group_3_0_2 - item-60 at level 6: table with [2x3] - item-61 at level 7: unspecified: group rich_cell_group_3_0_1 - item-62 at level 8: text: Cell 1 - item-63 at level 7: unspecified: group rich_cell_group_3_1_1 - item-64 at level 8: text: Cell 2 - item-65 at level 7: unspecified: group rich_cell_group_3_2_1 - item-66 at level 8: text: Cell 3 - item-67 at level 6: text: - item-68 at level 5: unspecified: group rich_cell_group_4_1_2 - item-69 at level 6: text: Rich cell + item-54 at level 6: inline: group group + item-55 at level 7: text: Simple cell with + item-56 at level 7: text: bold + item-57 at level 7: text: and + item-58 at level 7: text: italic + item-59 at level 7: text: text + item-60 at level 5: unspecified: group rich_cell_group_3_0_2 + item-61 at level 6: table with [2x3] + item-62 at level 7: unspecified: group rich_cell_group_3_0_1 + item-63 at level 8: text: Cell 1 + item-64 at level 7: unspecified: group rich_cell_group_3_1_1 + item-65 at level 8: text: Cell 2 + item-66 at level 7: unspecified: group rich_cell_group_3_2_1 + item-67 at level 8: text: Cell 3 + item-68 at level 6: text: + item-69 at level 5: unspecified: group rich_cell_group_4_1_2 + item-70 at level 6: text: Rich cell A nested table - item-70 at level 6: table with [2x3] - item-71 at level 7: unspecified: group rich_cell_group_4_0_1 - item-72 at level 8: text: Cell 1 - item-73 at level 7: unspecified: group rich_cell_group_4_1_1 - item-74 at level 8: text: Cell 2 - item-75 at level 7: unspecified: group rich_cell_group_4_2_1 - item-76 at level 8: text: Cell 3 - item-77 at level 6: text: - item-78 at level 4: inline: group group + item-71 at level 6: table with [2x3] + item-72 at level 7: unspecified: group rich_cell_group_4_0_1 + item-73 at level 8: text: Cell 1 + item-74 at level 7: unspecified: group rich_cell_group_4_1_1 + item-75 at level 8: text: Cell 2 + item-76 at level 7: unspecified: group rich_cell_group_4_2_1 + item-77 at level 8: text: Cell 3 + item-78 at level 6: text: item-79 at level 4: inline: group group item-80 at level 5: text: After table with item-81 at level 5: text: bold diff --git a/tests/data/docx/groundtruth/docx_rich_cells.docx.json b/tests/data/docx/groundtruth/docx_rich_cells.docx.json index b594fb627e..d32ae8e2ca 100644 --- a/tests/data/docx/groundtruth/docx_rich_cells.docx.json +++ b/tests/data/docx/groundtruth/docx_rich_cells.docx.json @@ -240,17 +240,7 @@ { "self_ref": "#/groups/11", "parent": { - "$ref": "#/texts/0" - }, - "children": [], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/12", - "parent": { - "$ref": "#/tables/0" + "$ref": "#/groups/12" }, "children": [ { @@ -288,6 +278,20 @@ } ], "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/12", + "parent": { + "$ref": "#/tables/0" + }, + "children": [ + { + "$ref": "#/groups/11" + } + ], + "content_layer": "body", "name": "rich_cell_group_1_1_2", "label": "unspecified" }, @@ -311,17 +315,7 @@ { "self_ref": "#/groups/14", "parent": { - "$ref": "#/texts/34" - }, - "children": [], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/15", - "parent": { - "$ref": "#/tables/1" + "$ref": "#/groups/15" }, "children": [ { @@ -341,6 +335,20 @@ } ], "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/15", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/14" + } + ], + "content_layer": "body", "name": "rich_cell_group_2_1_1", "label": "unspecified" }, @@ -824,9 +832,6 @@ { "$ref": "#/tables/0" }, - { - "$ref": "#/groups/11" - }, { "$ref": "#/texts/33" } @@ -1211,7 +1216,7 @@ { "self_ref": "#/texts/20", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1230,7 +1235,7 @@ { "self_ref": "#/texts/21", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1249,7 +1254,7 @@ { "self_ref": "#/texts/22", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1268,7 +1273,7 @@ { "self_ref": "#/texts/23", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1287,7 +1292,7 @@ { "self_ref": "#/texts/24", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1306,7 +1311,7 @@ { "self_ref": "#/texts/25", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1325,7 +1330,7 @@ { "self_ref": "#/texts/26", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1344,7 +1349,7 @@ { "self_ref": "#/texts/27", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1363,7 +1368,7 @@ { "self_ref": "#/texts/28", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1382,7 +1387,7 @@ { "self_ref": "#/texts/29", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1401,7 +1406,7 @@ { "self_ref": "#/texts/30", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -1479,9 +1484,6 @@ { "$ref": "#/tables/1" }, - { - "$ref": "#/groups/14" - }, { "$ref": "#/groups/24" }, @@ -1518,7 +1520,7 @@ { "self_ref": "#/texts/36", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -1537,7 +1539,7 @@ { "self_ref": "#/texts/37", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -1556,7 +1558,7 @@ { "self_ref": "#/texts/38", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -1575,7 +1577,7 @@ { "self_ref": "#/texts/39", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -1594,7 +1596,7 @@ { "self_ref": "#/texts/40", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2603,7 +2605,7 @@ "width": 48.0, "height": 48.0 }, - "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAASnElEQVRogcVZCXhU1b3/3Tt3lsxM9t2QZbIACWSDhLCIbBVKsCagEuhLVCggtIBFRJEPHhaf2KqotOQVRFoofNJSIRFBFiUQkCYIJLIIJqlhmpB9zyRhMtv/fefczCQBntqW973/952cyT33nPv77/9zjgIPmAwGw0N6vV7T2dnZ86DXvh8JD2qh6Ojo8A8//HBPamrqJIfDYX/jjTf+s7q6um7UqFHJgYGBgTU1NTV5eXmHCgoKvnA4HA/qs/8+RUdHh65du3ZVTU2NsaqqijZu3EglJSXEyGazUXd3Nw0ki8XSU1xcfGbDhg1rYmNjDf8voEVRxBNPPJFeUFBwlOFkwLq6uigiIoIiApSUlJRE2dnZ5ObmRgBo6NChlJubS3a7ne4i+/nz509lZ2c/IUnSA7OG76SnnnrqsfLy8msuBHY7nT9/nubPn09pQ7V04b04DvqZR/3o74emU/vH42j9XH/+TKvVUlpaGr388stUVFQ0iBOj0VjGGPk/Ax4UFOSbn5//ofODTOJbt26lyMhIDo61R5M9iM7NpHVP+pHt9I/I8kkKLZjqRSpJcL0zsMXExPA1TCaTi5Hjx4/nDRkyJPCBgp82bdqE1tbWhj4bpi1btpCHh8cgMMNCVPT8T3yp9c+JRMfHEn0+UW6fPUx0PI1MB+Kp8HUDrX/Kn0aEqgfN9fT05IxYrVbORGdnZ2tGRsaMBwJ+6dKlOVar1cwWLi8vp+Tk5EEfnxKvo9P/FUl06hGiLzOJruUQXX+aqDSL6Otn+ht79tU8ovMzOUNfvGGg2WPdB62VmppKlZWVTmXY1q1bt/L78Cm+a/CFF15Y8tvf/vYPoihK+fn5mD59Oqqrq/mYp1bEruUh2LIoFBHh3oDDBnj4Ao1VQKMRIALUWqC1Hmi+DUgqwE0PaHSApx/Cwv2RNVaDnySpcbHiDurbbaitrcWuXbuQmJiIoUOHitOmTZsJoKuwsLDon2Zg/vz5mdu3b98jCIK4f/9+9j8sFgsfS4xQo/D1SEwcoQPIAVh7AbsV6GwBLHf6F2mtA+6YALsdEAWgqRpoa+hnxN0HDwXq8ex4CbXNvSi9ZebfOHDgAGMAI0eOxOTJk39UV1dXefny5as/mIFRo0aNOHLkyAlJklRMIgsWLIAz+WSMccexjRHw85Duncik7iTG0MD/e+8ADjsgKYHuTpm5nk7AMwCSbyAyRgI6yY7PrnTzbx06dAhDhgxhWIT09PTHTp8+fbyqqqr27k/eE3t1Op2mtLT0UkxMzIgzZ84wB3aBnxqvw/GNEVA+qJDt7gN4+gOiQjax2gr8clsFth5p5cOSJIFhmDBhAm7fvl2ZkJCQ2NbW1jVwCfHuNd9+++3XGfiamho8+eSTLvAjQtXIXxf24MAzMrUCt8uAqhuAqQUIicGWpQZMidfyYZvNhjlz5qC+vp5pI/J3v/vdu3cvMQjNsGHDIq5fv17GTGfWrFn49NNPZS4FoOSdKCRGaAZPfZC5080d8A7iJvbtxSsYvqwMtr6Safbs2dykADhSUlISLl++/LVz2iANbNq06VUG/uTJky7wjJZN90ZiiAqwOgAbAXbWHHJzkNxoYPsXGGDOXlsBdDQhKi4cS2b4uIby8vJQWFjI8b711ltvD5zmkmFkZGRIWVlZJWMgLS0NX375JX+uUgCV70UixFspvy30Sd45UxDu/T3wf9yt5wHvE8HBNXyXKt19UFnZjOglN1xx4OGHH8a5c+f477FjxyZduHDhCgZqYOXKlSuc0neCZzQvzR0hOlGWPmsWO3YXtCFhTSXcnylD8JJy/Pz9OrR32ACrve8dR//7zsbsoU9z31Sb8eNfGeE29wZUT3yNuOUVOHC+o19zplZEBmsweYQWOrXATfiLL75wagHLly9f7sQnyoISkJ2dncN+79ixgw9oVbJUskbrBgFZs78Jr57UYEbWSvgGhaG+w47ff96OCa/+Q2ZiIHiLfTATFgeu37qDieurEDtpEaZNT+dWePN2L7LeqsZ7nzT3m6WlFzOS9ejpJSQZZN9zYps9e/aTKpWqP46npqbGs9zd09NDarVcp8QHK3nf/U4Y0bYIotwIuvzKQ/yZs5IsLi4eVAosm+xB9EEU0a5ouf0hmuiPMUS7+9qeGBoXraFly5a5irfAwEDXfEkBqt8RQ/Tn4UR/iaWCjWH8ec4jnrzXaDRkNvOqhlh95tLAlClTprCeqai3txdKEQh2FxGgF8EDWp8ED16SQ7CznHD2TvqIjd9tOsys+rTSabLhwrdmVFZW8vebm5thMplc82124Phlk2uuwUcWcqi3AkoFYDabXX4wefLkyS4GUlJSxrD+7NmzfHBkkIQeC8FPK/bbtMWBhg47/Pz8eFmRnJyMefPmDWKgqcv5rn2Q2Th/t3XYuHWcOHEC4eHhiIqKQk9P/9bZ398fLdyXZMa9lPLz3l4H4oeo+e/Tp087rWaMi4Hhw4cPZ/2VK9yxMdxXgsAjIg2SZqSXCBah7HY7vvrqK94PpAhvxX004HA590NaAZo+y62qqkJnZ+eg+WztoX79a9gtciIQCRgeJHNTUlKCgZg5A+Hh4WGsr6io4IPhHiK8VEBDV//HHRYHNAJ/lxdadxNL+8vSZIe/1WBFzr5mjHyzDvFv1WHx/hbUtlihtBMWjNFBqVTeM3/q1KlQSiLM5n7NNbVa+ZinWkC4t8x5WVkZ70NCQsIVCgUktpiHhwfPGixlM/JTCQhzF/HJHUK7yQ4vjcBj9RMxKmQc3IWnf7EB7e3t3OTYIlqtFiGma1iVJuJMxR2s+NyEd17PwZ7ps0C2HhzJ34cfbS7A7kwvvPljTzTbFej0ikNbWxvUajWvt1paWnD79AdIH+srm50gRydGQzxEtHTL2qirq3MKTO3p6akT9Hq90mQy8TqZbdaZ2eRO1UIlCVh8shv7H9NjXqzalYBYKP/kWwv+1qqDMiAK5rZ6jNE1ImuEBleabMj+1ITPto5GUDADUgGw2kkXg39UVeKx5RU4/JQ3wr0U+Mu1O6igUKh0HqCmv2NmlANJD6kGJcuVH7dj15ddOLEkANfqrfj5wTYO3mq1co0HBwf7STZWMfURyweMAYeNEOcjwl8j4I9XzZgX1Z+FFQKQGSEh02ABhJtAOJupQsltC54+ZsKBVf54Z88NvP4f3lCqRUApwNJ5E9v2t2LnumDMfq0WB+Z4YX6cGhCamOsDkQywJJtO33dsRDh0rQdpoSpIDgLZ7j1LYrs2icVVs9ncodFoPPV6PXes7l4HRLuI2ZES3r9hxd9uWzE+SDG4NBAElLfbcfBbKy412FBjJuQv9EKA6EBDvQVCuxVQyQwoFALqblsw3EvAnnVBmPt2I4ZrBSQFSpg3QoMIL0V/idHX9l0xo6bTgdXj1TyLd92RGXBzc+PSZzuOtrY2k9hnV9z4AwPlw4DevtT/ZLgEvQSsLOyBrXdwZLljtiM9zwTJasPq0UoUZ7sjekgsPPwSsGdJKiQpHBBCATEcCikK+156BF6+KUg0ROHym8FYnOGBHpMVj+5tk6ONtT/0dvfYsf6UCWEeIsYESryAbDLJES8oKIj3ra2tjRaLxcFZKS8vLzMYDMNiYmJ4JKo1OaDtK0zWxiuxvtSK57+4g9xxapd9ig5ZwMZWB1RWC+602DCk4jI03r6QfB+C5OENQa0Bi8dk7YG9uwHWjnr0tHeist6KrxvsXMJ6Zp0DTIfJeeERE8eQ+6gOCrtc7TZ3yQwMGzYMTszcmdmf0tLS0hkzZjyelJTEy+jiJgfeTCTc6CVM8xdQYRDx39/YeG7YmqqCQgSYW5+b6YbNVy14syEA+m49uluboOutgZ+6Bh6SAEmUq2sm4E4rodkqwKz1hadvGA+lkfgaZ+foIPYxwCr1xQU9OFBmwS8S1Ej2VXBL8NeJuNIgu+qoUaOc+aDUxUBhYWHh2rVrWXrG5s2bcaWdYLM4ECwBdWbgOYOC791zy2y42GRHbqoSKT4ifEUgM0REScBQ5OTkOB0L3d3dvLHUz8IsC5U6nQ4ajUZOjgC++eYbNB7+Gjomc6uA03U2rDpvxpUWB56LUyI7RsnBs3LeUxDwVaOsARZynZid7sjiuKqtra3d4XC4eXt78w/vTBSxMFzEdROhxy6rt6DJgd+UO9BpA8b5Cmi1AO5KIGzybHYE49oEsSTJALOa5+jRozzssTKBqZ9pOTc3F+fPn+fMDNEK8HcTUNrigK8aeCVRhQlBksuZ43wU+KjSip+dMfN8w3KHJEn2wMBA3+bm5g6ugZ6eHsuxY8c+zsjImMe2kgcPHsTvbzmwKASI1QDXTICFCFO8gS/9BJxqFzBzqg/Ghqpw5KIJH549i+3bt3OQDBhrRqORM5Gens435Z6enrh58yZ/T2wtQdUHQxHkJeF4iQlbPm6G0NKDpcOUmOAnynsHQUCEuwAPImy/Lh/nZGZmQqVSsQR6ioHHwA3Nzp07d7J+8eLFso11AgVNxOsQ7lkO4GCtAxfMClzYHIENP/aC0GvHqlQ3XlWyumj37t28UGOMvPjii3j33Xe51A8fPozXXnuNJ8ozpwvw4c8CEKgkSA4HHhvtjtOvGbDn+RBsLbfhY6NNdgabA+4gnKmx4mKzHEIXLVrE+927d//RlbsGJoaSkpKi5OTksWPGjMHFixeR5A4cTRFQZRZQZybMv0Io3BSBNJYTOq1oa+zFhPeb8E0bcbNj0kFfmc3K3qKiIs4cq2AnTpyIhIQExI+IxcqH9Xg8QYtJ7GBMrZD3rSoRF429eGRdJXKTFIjzFOGpEpBTbMXlNsL48eO5Zqurq7+Njo4eZrFYBleSjDIyMqazzcJnn33m2mS8ZAAVjRNpbhAoc7Re3rC8E0bFi33ppTFu9NMYJY0dO5YuXbpEBw4coNra2rvvAKixsZEOHjxI1dXVFBISQqlBCqpe6UtHn/Yh+k0I0XthRL838A3Q89O9aKIvqGiSRK8ME104zpw5w9dauHDh/HuAD6SzZ8+eYC9mZmbKuyQBtHOkQN4S6MTzwURbQok2BhGt8qG9kzX8nX379vHj9hMnTtCGDRv4XUFOTg4/xa6pqRnEzEcffUQ6pUD+GtDtZz2IVvsQrfMn+lUQ0a9D6OqaIP7N3YkCqUUZ/Ny5c/lcZiHCXQcA95zsxMXFRV26dOmrjo4OPTtkbWxshKcE9BDQuXkIND1W3DSasepUF5REMHrHsTzCfYft5mJjY7nTjh49mpe+LKqtXr0aN27c4GbGADQ0NEAvWPFSnISrHYQPJrtBq5O4OdlUIjS/boJeAbC9TXBwMN+neHl59Y4fPz7l0qVL179TA4yee+65bMZxYWEhiaKsRm83gepX+xP90ptooZ42xyv483PnztGpU6coLy+P2tra6NatW/SnP/2JqZoWLVrEn7ErJnZf5qS6ujrXxcgbwwWiTIkoS030tJYacvSk7JO8QqHgtz+M1qxZ84vvBT6Q/vrXv+5hE3fs2EGCIN+wxHiJVPmUlsxzVJTsCXr22Wf54k1NTbR3715asmQJZWVl0eHDh11g8/PzuUkxYjcxmzZt4hv5hIQEGaQA2hoLopkiGaeJNFTff0iwfft2Pu/YsWOH7jad7yV2bHH8+PFDbAEmUacmPCTQBG9wx2WnGPcjp7Tr6+u59I8cOUIvvPACBz5u3DhaunQp7weeaGQEgDylfskzgTBiPqnVatX/HPo+0mg0ypMnT+Y7JanX6+Ujl/h4amlpuS/4gZIPDQ0ld3d3CgsLo/T0dHrxxRf5NezmzZvJ39//vvdm7OqKMcyoqKioQK/Xu30Xxu/VC1Pd/v37d2VlZS1kuY41VjK0trbyGxUW59kegv3PnJOVDywLszKBnTqwssLLy4vXQyxPsFqebUX37Nlzz7eY87PLlNDQULz//vvvrVixYo3FYrHdF9gPJSYBo9FYzhyVHSyxm0WmAV9f33ukx3zF29ubAgICeLyPioritj5x4kR6/PHHacGCBfz+mJnIwHlsLWbvzPTYBd/ChQuz/i3QA2n9+vWrmTqZWplzOu2e9ezy2mAw3NcUfkhjDG7bts11m8+ucdl17gMDz2jbtm1vOa8+jx49enDFihVLZs2aNYX9ttvtVnbRzcLtqlWraNSoUaRUKv9XwGxs9OjR3KFZ+O27ubcXFBR8OmnSpDH/Cr7v9QFRFAUfHx93drVjt9sH7axDQkL8s7Ozfzpnzpw5KSkp49ltJiudmV+w44+uri7uC+7u7jwhsZqo70zIUVpaeiEvLy9v7969+4xGY92/Av4HMfBDyc/PzyMtLS01Pj4+wWAwGIKCgoLc3Nx0TADd3d3dTU1NjUaj0Xj16tWrxcXFFxobG9sfxHf/Bxoc4AU61vbkAAAAAElFTkSuQmCC" + "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAScElEQVR4nM1ZCXhUVZb+36tXlUpVZd/NWlmAhM4GCWERWVxQcExAIdCTuCAEaAUbAUU+GGwcsVtE5ZOMLNINTT5pUQggyGITCEgnSEhkEUzSxnRCyL5WUlRqO/Pd+6qKBB3ttumZOd9369Zb7n1nP+eeA9xl0Ov194SFhQXgfwmEu7VRbGxs5IcffrgrPT19gt1ut73xxhv/UV9f3zhixIjUoKCgoIaGhobCwsL9RUVFX9jtdvy/gdjY2PCVK1cubWhoqK2rq6O1a9dSeXk5MbBardTX10cDwWw2G0tLS0+vWbNmRXx8vP7/BGlRFPH4449PLSoqOsLwZIj19vZSVFQURQUqKSUlhXJycsjd3Z0A0JAhQyg/P59sNtsgYojIdu7cuZM5OTmPS5J017ThR2HmzJmPVlVVXXFhYLPRuXPnaM6cOZQxREPn303gSD/1oD/9df9D1HVwDK2eFcDvaTQaysjIoJdffplKSkoGUVJbW1vJCPmXIR4cHOx34MCBD50fZBzftGkTRUdHc+TYeDDVk+jsI7TqCX+ynnqAzJ+m0TOTvUklCa53Bo64uDi+h8FgcBFy7NixwrCwsKC7ivz9998/rqOjo9mhw7Rx40by9PQchMzQUBW98G9+1PGnZKJjo4n+PF4en99LdCyDDHsTqfh1Pa2eGUDDw90GrfXy8uKEWCwWTkRPT09HZmbmlLuC/MKFC3MtFouJbVxVVUWpqamDPj4pUUun/jOa6OR9RF9mEV3JJbr6JFFFNtHXT90e7N5Xs4nOPcIJ+uINPU0f7TFor/T0dKqpqXEKw7pq1aol/xTyL774Yp5zt8LCQq7DLq5pRCpYGkb0aQrRibFEx0fLSDOOH0wkOjWJ6NIviYofIDqaTnQ+czBBF2cSnRhDZRtjKFWvdu2r0+no8OHDLpVau3btsh/D8X+0/Dlz5mQVFBR8IoqiYs+ePcjNzYXNZuPPkqPccHBVJCIDVQN2EgBBBOzyO3DTAJZ+x7UAePoCRgNABNwTA6i18n9DB/ob6/Cr/Dr8/mQXXypJEnbv3o3Zs2ezS/uCBQue2rZtW8HfTcCIESOGl5SUXFCpVO47duxAXl4enMEnc5QH9iwPh7tKxM8CpZtMqM0KqNRAYCTzy0BDNTZ8VIeXdjU7+CFg+/btePbZZxnjzJMmTRp39uzZsp8kQKvVqisqKsri4uKGnz59mhmwC/nJiVocWxsF5d1y2R6+gFcAICoASQXcrMavN1dj0+EOlyQYDuPGjcONGzdqkpKSkjs7O3sHbvE9Nr711luvM+QbGhrwxBNPuJAfHu6GA6si7h7yDAwdwI1KoO4aYGgHQuOwcaEekxI1/LHVasWMGTPQ1NSEsLCw6Pfee++dO7cYhM3QoUOjrl69WilJkmratGn47LPPZCoFoPztGCRHqQcvvZux090D8AkGJCW+vXAJwxZVwupImaZPn479+/ezv/a0tLSkixcvfv2DEli3bt2rDPkTJ064kGew6CEfJIeqAIsdsBJgY8MuDzvJgwaOn0HALQNXIXS3IiYhEnlTfF2PCgsLUVxczPHdsGHDWwOXuXgYHR0dWllZWcMIyMjIwJdffsnvqxRAzbvRCPVRym9zbzNgpfN64P+B14O+4rhwXhOBMVl0vucED1/U1LQhNu8a5weDe++9F2fPnuX/R48enXL+/PlLnCLnmiVLlix2ct+JPIPZGR4I1Yoy99kw27CzqBNJK2rg8VQlQvKq8KttjejqtgIWm+Mdx7sDB9MHh+S+qTfh4d/Uwn3WNage/xoJz1dj77nu25IzdCA6RI2JwzXQuglchb/44gunFPD8888/78RPdLqsnJycXPZ/69at/IFGJXMle6R2ECIr9rTi1RNqTMleAr/gCDR12/D+n7sw7tW/yUQMRN7sIMh1bcfV725h/Oo6xE+Yh/sfmsq18PqNfmRvqMe7n7bdVktzP6ak6mDsJ6ToZdtz4jZ9+vQnVCqV5OJyenp6Iot6RqOR3NzkPCUxRMnnvrcjiDZHEeVH0cVX7uH3nJlkaWnpoFRg0URPog9iiHbEyuP3sUR/iCPa6Ri74mhMrJoWLVrkirRBQUGu9ZIC1LQ1juhPw4g+iqeitRH8fu59XnxWq9VkMvGshlh+5pLApEmTJrGZiai/vx9KEQjxEBGoE8EdmoOD+8pkF1xfXz9odsIn7PmdqsPUyiGVHoMV5781oaamhr/f1tYGg8HgWm+1AccuGlxr9b4yk8N9FFAqAJPJ5LKDiRMnTnQRkJaWNorNZ86c4Q9/ESzBaCb4axy6zxAw29HcbYO/vz9LM5CamuoM9S5o7XW+O0B1BqhUZ7eVa8fx48cRGRmJmJgYGI1G1/qAgAC0c1uSCfdWyvf7++1IDHPj/0+dOuXUmlEuAoYNGzaMzZcuccPGMD8JLIMn5gIGcDPaWwTzUCwn+uqrr1y5kROifBQ/IAGHFCx23KMRoHZobl1dHXp6egatZ3sP8b+9h40Rz5AkYFiwTE15eTkG4swJiIyMjGBzdXU1fxjpKcJbBTT33v643WyHWuDvYsiQIbgTWNhflCEb/HfNFuQWtOEXbzYicUMj5u9px812C5Q2wjOjtFAqHawdAJMnT4ZSEmEy3ZZca4eFP/NyExDpI1NeWVnJ59DQ0EiFQgGJbebpyVJF8JDNwF8lIMJDxKe3CF0GG7zVzJUJeDxOhcx9O/Dkc2vQ1dXFVY5totFoEGq4gqUZIk5X38LiPxvw9uu52PXQNJDViMMHCvDA+iLszPLGmw97oc2mQI93Ajo7O+Hm5sbzrfb2dtw49QGmjvaT1U6QvRODME8R7X2yNBobG/ksSZKbl5eXVtDpdEqDwWB2HtaZ2uRP1kAlCZh/og97HtVhdrybKwAxV/7pt2b8pUMLZWAMTJ1NGKVtQfZwNS61WpHzmQGfbxqJ4BCGSDXAcidtHP5WV4NHn6/GoZk+iPRW4KMrt1BN4VBpPUGtf8UjMXak3KMaFCyXHOzCji97cTwvEFeaLPjVvk6OvMVi4RIPCQnxl6wsY3IAiweMALuVkOArIkAt4A+XTZgdczsKKwQgK0pClt4MCNeBSLZShfIbZjx51IC9SwPw9q5reP3ffaB0EwGlAHPPdWze04Htq0Iw/bWb2DvDG3MSWFrdykwfiGYIS7LqOL5jJcL+K0ZkhKsg2QnkTIwGADu1ScyvmkymbrVa7aXT6bhh9fXbIdpETI+WsO2aBX+5YcHYYMXg1EAQUNVlw75vLShrtqLBRDgw1xuBoh3NTWYIXRaAnRmUAhQKAY03zBjmLWDXqmDMeqsFwzQCUoIkzB6uRpS34naK4RgFl0xo6LFj2Vg3HsV7b8kEuLu7c+4DsHV2dhq4ETc2NnLlDwqSiwH9jtD/RKQEnQQsKTbC2j/Ys9wy2TC10ADJYsWykUqU5nggNiwenv5J2JWXDkmKBIRwQIyEQopBwUv3wdsvDcn6GFx8MwTzMz1hNFjw4O5O2ds40xCLHX1GG1afNCDCU8SoIIknkK0G2eMFBwfzuaOjo8VsNts5KVVVVZV6vX5oXFwc90Q3DXZoHInJykQlVldY8MIXt5A/hold5pRolxlc22GHymLGrXYrwqovQu3jB8nvHkiePhDc1GD+mCxG2PqaYelugrGrBzVNFnzdbOMc1jHtHKA6jM9zDxs4DvkPaqFgRmcntPXKBAwdOhROnLkxs5+KioqKKVOmPJaSksLT6NJWO95MJlzrJ9wfIKBaL+K/vrHy2LApXQWFCDCzPvuIO9ZfNuPN5kDo+nTo62iFtr8B/m4N8JQESKKcXTMG91gIbRYBJo0fvPwiuCuNxtc4M0ML0UEAy9TnFxmxt9KM55LckOqn4JoQoBVxqVk21REjRvC5vLy8wkVAcXFx8cqVK1l4xvr163Gpi2A12xEiAY0mYIFeAbID+ZVWXGi1IT9diTRfEX4ikBUqojxwCD/0OwwLfX19fLDQz9wsc5VarRZqtVoOjgC++eYbtBz6GlrGc4uAU41WLD1nwqV2OxYkKJETp+TIs3TeSxDwVYssAeZynTg7zZH5cVVnZ2eX3W539/Hx4R/enixibqSIqwaCkRcWBBS12vG7Kjt6rMAYPwEdZsBDCURMnM5KMK5DEAuSDGGW8xw5coS7PZYmMPEzKefn5+PcuXOcmDCNgAB3ARXtdvi5Aa8kqzAuWHIZc4KvAp/UWPDsaROPNyx2SJJkCwoK8mtra+vmEjAajeajR48ezMzMnM2Okvv27cP739kxLxSIVwNXDICZCJN8gC/9BZzsEvDIZF+MDlfh8AUDPjxzBlu2bOFIMsTYqK2t5URMnTqVH8q9vLxw/fp1/p7YUY66D4Yg2FvCsXIDNh5sg9BuxMKhSozzF+WzgyAgykOAJxG2XOVhCllZWVCpVCyAnmTI89jl9KnbWQ0DwPz582Ud6wGKWonnIdyy7MC+m3acNylwfn0U1jzsDaHfhqXp7jyrZHnRzp07eaLGCFm+fDneeecdzvVDhw7htdde44Hy9KkifPhsIIKUBMlux6MjPXDqNT12vRCKTVVWHKy1ysZgtcMDhNMNFlxok13ovHnz+Lxz584/uGLXwMBQXl5ekpqaOnrUqFG4cOECUjyAI2kC6kwCGk2EOZcIxeuikMFiQo8FnS39GLetFd90Elc7xh1nms3S3pKSEk4cy2DHjx+PpKQkJA6Px5J7dXgsSYMJw7WAm0I+t6pEXKjtx32rapCfokCClwgvlYDcUgsudhLGjh3LJVtfX/9tbGzsULOZpbx3QGZm5kPssPD555+7Dhkv6UElY0SaFQzKGqmTDyxvR1DpfD96aZQ7/TJOSaNHj6aysjLau3cv3bx5884eALW0tNC+ffuovr6eQkNDKT1YQfVL/OjIk75EvwslejeC6H09PwC98JA3jfcDlUyQ6JWhXP58nD59mu81d+7cOfgxOHPmzHH2YlZWlnxKEkDbfyGQjwQ6/kII0cZworXBREt9afdEuaZZUFDAy+3Hjx+nNWvW8F5Bbm4ur2I3NDQMIuaTTz4hrVKgADXoxtOeRMt8iVYFEP0mmOi3oXR5RTD/5s5kgdxEGflZs2bxtUxDWLozEL5X2UlISIgpKyv7qru7W5ecnIyWlhZ4SYCRgJ71YVAbLbhea8LSk71QEqHWJ4HFEW477DQXHx/PjXbkyJE89WVebdmyZbh27RpXM4ZAc3MzdIIFLyVIuNxN+GCiOzRaiauTVSVC/dtW6BQAO9uEhITwc4q3t3f/2LFj08rKyq7ip2DBggU5jOLi4mISRVmMPu4CNS0LIPq1D9FcHa1PVPD7Z8+epZMnT/LqdWdnJ3333Xf0xz/+kYma5s2bx++xFhPrlzmhsbHR1Rh5Y5hAlCURZbsRPamh5lwdKR2cVygUvPvDYMWKFc/hH4GPP/54F1u4detWEgS5wxLnLVLNTA2ZZqgo1Qv09NNP881bW1tp9+7dlJeXR9nZ2XTo0CEXsgcOHOAqxYB1YtatW8cP8klJSTKSAmhTPIgeEan2fpGG6G4XCbZs2cLXHT16dP+dqvOTwMoWx44d2882YBx1SsJTAo3zATdcVsX4IXByu6mpiXOf1ftffPFFjviYMWNo4cKFfMaAikZmIMhLus15xhAGzCY1Go18IP5HQa1WK0+cOHHAyUnWfOAll8REam9v/0HkB3I+PDycPDw8KCIigqZOnUrLly/nbdj169dTQIDc+MMdg7WunA2OkpKSIp1O5/5jOP6kXJjo9uzZsyM7O3sui3VssJSho6MDN2/e5H6enSHYNTNOlj6wKMzSBFZ1YGmFt7c3z4dYnGC5PDuK7tq163vfYsbPminh4eHYtm3bu4sXL15hNptdB66fBYwDtbW1VcxQWWGJdRaZBPz8/L7HPWYrPj4+FBgYyP19TEwM1/Xx48fTY489Rs888wzvHzMVGbjOz8+P6ztTPdbgmzt3bjbuFqxevXoZEycTKzNOp96zmTWv9Xr9D6rC3zNiYmJo8+bNrm4+a+Oydi7uJmzevHkD25xx5siRI/sWL16cN23atEnsv81ms7BGN3O3S5cupREjRpBSKZckf2iwZyNHjuQGzdyvTe7c24qKij6bMGECL1T9o/CTNiCKouDr6+vBWjs2G6u83obQ0NCAnJycX86YMWNGWlraWFEUJZY6M7tg5Y/e3l5uCx4eHjwgsZzIUROyV1RUnC8sLCzcvXt3QW1trVwr+VcQ8PeCv7+/Z0ZGRnpiYmKSXq/XBwcHB7u7u2sZA/r6+vpaW1tbamtray9fvny5tLT0fEtLi9yS/CfhvwEPv/IpB1dpMAAAAABJRU5ErkJggg==" }, "annotations": [] }, @@ -2626,7 +2628,7 @@ "width": 48.0, "height": 48.0 }, - "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAASnElEQVRogcVZCXhU1b3/3Tt3lsxM9t2QZbIACWSDhLCIbBVKsCagEuhLVCggtIBFRJEPHhaf2KqotOQVRFoofNJSIRFBFiUQkCYIJLIIJqlhmpB9zyRhMtv/fefczCQBntqW973/952cyT33nPv77/9zjgIPmAwGw0N6vV7T2dnZ86DXvh8JD2qh6Ojo8A8//HBPamrqJIfDYX/jjTf+s7q6um7UqFHJgYGBgTU1NTV5eXmHCgoKvnA4HA/qs/8+RUdHh65du3ZVTU2NsaqqijZu3EglJSXEyGazUXd3Nw0ki8XSU1xcfGbDhg1rYmNjDf8voEVRxBNPPJFeUFBwlOFkwLq6uigiIoIiApSUlJRE2dnZ5ObmRgBo6NChlJubS3a7ne4i+/nz509lZ2c/IUnSA7OG76SnnnrqsfLy8msuBHY7nT9/nubPn09pQ7V04b04DvqZR/3o74emU/vH42j9XH/+TKvVUlpaGr388stUVFQ0iBOj0VjGGPk/Ax4UFOSbn5//ofODTOJbt26lyMhIDo61R5M9iM7NpHVP+pHt9I/I8kkKLZjqRSpJcL0zsMXExPA1TCaTi5Hjx4/nDRkyJPCBgp82bdqE1tbWhj4bpi1btpCHh8cgMMNCVPT8T3yp9c+JRMfHEn0+UW6fPUx0PI1MB+Kp8HUDrX/Kn0aEqgfN9fT05IxYrVbORGdnZ2tGRsaMBwJ+6dKlOVar1cwWLi8vp+Tk5EEfnxKvo9P/FUl06hGiLzOJruUQXX+aqDSL6Otn+ht79tU8ovMzOUNfvGGg2WPdB62VmppKlZWVTmXY1q1bt/L78Cm+a/CFF15Y8tvf/vYPoihK+fn5mD59Oqqrq/mYp1bEruUh2LIoFBHh3oDDBnj4Ao1VQKMRIALUWqC1Hmi+DUgqwE0PaHSApx/Cwv2RNVaDnySpcbHiDurbbaitrcWuXbuQmJiIoUOHitOmTZsJoKuwsLDon2Zg/vz5mdu3b98jCIK4f/9+9j8sFgsfS4xQo/D1SEwcoQPIAVh7AbsV6GwBLHf6F2mtA+6YALsdEAWgqRpoa+hnxN0HDwXq8ex4CbXNvSi9ZebfOHDgAGMAI0eOxOTJk39UV1dXefny5as/mIFRo0aNOHLkyAlJklRMIgsWLIAz+WSMccexjRHw85Duncik7iTG0MD/e+8ADjsgKYHuTpm5nk7AMwCSbyAyRgI6yY7PrnTzbx06dAhDhgxhWIT09PTHTp8+fbyqqqr27k/eE3t1Op2mtLT0UkxMzIgzZ84wB3aBnxqvw/GNEVA+qJDt7gN4+gOiQjax2gr8clsFth5p5cOSJIFhmDBhAm7fvl2ZkJCQ2NbW1jVwCfHuNd9+++3XGfiamho8+eSTLvAjQtXIXxf24MAzMrUCt8uAqhuAqQUIicGWpQZMidfyYZvNhjlz5qC+vp5pI/J3v/vdu3cvMQjNsGHDIq5fv17GTGfWrFn49NNPZS4FoOSdKCRGaAZPfZC5080d8A7iJvbtxSsYvqwMtr6Safbs2dykADhSUlISLl++/LVz2iANbNq06VUG/uTJky7wjJZN90ZiiAqwOgAbAXbWHHJzkNxoYPsXGGDOXlsBdDQhKi4cS2b4uIby8vJQWFjI8b711ltvD5zmkmFkZGRIWVlZJWMgLS0NX375JX+uUgCV70UixFspvy30Sd45UxDu/T3wf9yt5wHvE8HBNXyXKt19UFnZjOglN1xx4OGHH8a5c+f477FjxyZduHDhCgZqYOXKlSuc0neCZzQvzR0hOlGWPmsWO3YXtCFhTSXcnylD8JJy/Pz9OrR32ACrve8dR//7zsbsoU9z31Sb8eNfGeE29wZUT3yNuOUVOHC+o19zplZEBmsweYQWOrXATfiLL75wagHLly9f7sQnyoISkJ2dncN+79ixgw9oVbJUskbrBgFZs78Jr57UYEbWSvgGhaG+w47ff96OCa/+Q2ZiIHiLfTATFgeu37qDieurEDtpEaZNT+dWePN2L7LeqsZ7nzT3m6WlFzOS9ejpJSQZZN9zYps9e/aTKpWqP46npqbGs9zd09NDarVcp8QHK3nf/U4Y0bYIotwIuvzKQ/yZs5IsLi4eVAosm+xB9EEU0a5ouf0hmuiPMUS7+9qeGBoXraFly5a5irfAwEDXfEkBqt8RQ/Tn4UR/iaWCjWH8ec4jnrzXaDRkNvOqhlh95tLAlClTprCeqai3txdKEQh2FxGgF8EDWp8ED16SQ7CznHD2TvqIjd9tOsys+rTSabLhwrdmVFZW8vebm5thMplc82124Phlk2uuwUcWcqi3AkoFYDabXX4wefLkyS4GUlJSxrD+7NmzfHBkkIQeC8FPK/bbtMWBhg47/Pz8eFmRnJyMefPmDWKgqcv5rn2Q2Th/t3XYuHWcOHEC4eHhiIqKQk9P/9bZ398fLdyXZMa9lPLz3l4H4oeo+e/Tp087rWaMi4Hhw4cPZ/2VK9yxMdxXgsAjIg2SZqSXCBah7HY7vvrqK94PpAhvxX004HA590NaAZo+y62qqkJnZ+eg+WztoX79a9gtciIQCRgeJHNTUlKCgZg5A+Hh4WGsr6io4IPhHiK8VEBDV//HHRYHNAJ/lxdadxNL+8vSZIe/1WBFzr5mjHyzDvFv1WHx/hbUtlihtBMWjNFBqVTeM3/q1KlQSiLM5n7NNbVa+ZinWkC4t8x5WVkZ70NCQsIVCgUktpiHhwfPGixlM/JTCQhzF/HJHUK7yQ4vjcBj9RMxKmQc3IWnf7EB7e3t3OTYIlqtFiGma1iVJuJMxR2s+NyEd17PwZ7ps0C2HhzJ34cfbS7A7kwvvPljTzTbFej0ikNbWxvUajWvt1paWnD79AdIH+srm50gRydGQzxEtHTL2qirq3MKTO3p6akT9Hq90mQy8TqZbdaZ2eRO1UIlCVh8shv7H9NjXqzalYBYKP/kWwv+1qqDMiAK5rZ6jNE1ImuEBleabMj+1ITPto5GUDADUgGw2kkXg39UVeKx5RU4/JQ3wr0U+Mu1O6igUKh0HqCmv2NmlANJD6kGJcuVH7dj15ddOLEkANfqrfj5wTYO3mq1co0HBwf7STZWMfURyweMAYeNEOcjwl8j4I9XzZgX1Z+FFQKQGSEh02ABhJtAOJupQsltC54+ZsKBVf54Z88NvP4f3lCqRUApwNJ5E9v2t2LnumDMfq0WB+Z4YX6cGhCamOsDkQywJJtO33dsRDh0rQdpoSpIDgLZ7j1LYrs2icVVs9ncodFoPPV6PXes7l4HRLuI2ZES3r9hxd9uWzE+SDG4NBAElLfbcfBbKy412FBjJuQv9EKA6EBDvQVCuxVQyQwoFALqblsw3EvAnnVBmPt2I4ZrBSQFSpg3QoMIL0V/idHX9l0xo6bTgdXj1TyLd92RGXBzc+PSZzuOtrY2k9hnV9z4AwPlw4DevtT/ZLgEvQSsLOyBrXdwZLljtiM9zwTJasPq0UoUZ7sjekgsPPwSsGdJKiQpHBBCATEcCikK+156BF6+KUg0ROHym8FYnOGBHpMVj+5tk6ONtT/0dvfYsf6UCWEeIsYESryAbDLJES8oKIj3ra2tjRaLxcFZKS8vLzMYDMNiYmJ4JKo1OaDtK0zWxiuxvtSK57+4g9xxapd9ig5ZwMZWB1RWC+602DCk4jI03r6QfB+C5OENQa0Bi8dk7YG9uwHWjnr0tHeist6KrxvsXMJ6Zp0DTIfJeeERE8eQ+6gOCrtc7TZ3yQwMGzYMTszcmdmf0tLS0hkzZjyelJTEy+jiJgfeTCTc6CVM8xdQYRDx39/YeG7YmqqCQgSYW5+b6YbNVy14syEA+m49uluboOutgZ+6Bh6SAEmUq2sm4E4rodkqwKz1hadvGA+lkfgaZ+foIPYxwCr1xQU9OFBmwS8S1Ej2VXBL8NeJuNIgu+qoUaOc+aDUxUBhYWHh2rVrWXrG5s2bcaWdYLM4ECwBdWbgOYOC791zy2y42GRHbqoSKT4ifEUgM0REScBQ5OTkOB0L3d3dvLHUz8IsC5U6nQ4ajUZOjgC++eYbNB7+Gjomc6uA03U2rDpvxpUWB56LUyI7RsnBs3LeUxDwVaOsARZynZid7sjiuKqtra3d4XC4eXt78w/vTBSxMFzEdROhxy6rt6DJgd+UO9BpA8b5Cmi1AO5KIGzybHYE49oEsSTJALOa5+jRozzssTKBqZ9pOTc3F+fPn+fMDNEK8HcTUNrigK8aeCVRhQlBksuZ43wU+KjSip+dMfN8w3KHJEn2wMBA3+bm5g6ugZ6eHsuxY8c+zsjImMe2kgcPHsTvbzmwKASI1QDXTICFCFO8gS/9BJxqFzBzqg/Ghqpw5KIJH549i+3bt3OQDBhrRqORM5Gens435Z6enrh58yZ/T2wtQdUHQxHkJeF4iQlbPm6G0NKDpcOUmOAnynsHQUCEuwAPImy/Lh/nZGZmQqVSsQR6ioHHwA3Nzp07d7J+8eLFso11AgVNxOsQ7lkO4GCtAxfMClzYHIENP/aC0GvHqlQ3XlWyumj37t28UGOMvPjii3j33Xe51A8fPozXXnuNJ8ozpwvw4c8CEKgkSA4HHhvtjtOvGbDn+RBsLbfhY6NNdgabA+4gnKmx4mKzHEIXLVrE+927d//RlbsGJoaSkpKi5OTksWPGjMHFixeR5A4cTRFQZRZQZybMv0Io3BSBNJYTOq1oa+zFhPeb8E0bcbNj0kFfmc3K3qKiIs4cq2AnTpyIhIQExI+IxcqH9Xg8QYtJ7GBMrZD3rSoRF429eGRdJXKTFIjzFOGpEpBTbMXlNsL48eO5Zqurq7+Njo4eZrFYBleSjDIyMqazzcJnn33m2mS8ZAAVjRNpbhAoc7Re3rC8E0bFi33ppTFu9NMYJY0dO5YuXbpEBw4coNra2rvvAKixsZEOHjxI1dXVFBISQqlBCqpe6UtHn/Yh+k0I0XthRL838A3Q89O9aKIvqGiSRK8ME104zpw5w9dauHDh/HuAD6SzZ8+eYC9mZmbKuyQBtHOkQN4S6MTzwURbQok2BhGt8qG9kzX8nX379vHj9hMnTtCGDRv4XUFOTg4/xa6pqRnEzEcffUQ6pUD+GtDtZz2IVvsQrfMn+lUQ0a9D6OqaIP7N3YkCqUUZ/Ny5c/lcZiHCXQcA95zsxMXFRV26dOmrjo4OPTtkbWxshKcE9BDQuXkIND1W3DSasepUF5REMHrHsTzCfYft5mJjY7nTjh49mpe+LKqtXr0aN27c4GbGADQ0NEAvWPFSnISrHYQPJrtBq5O4OdlUIjS/boJeAbC9TXBwMN+neHl59Y4fPz7l0qVL179TA4yee+65bMZxYWEhiaKsRm83gepX+xP90ptooZ42xyv483PnztGpU6coLy+P2tra6NatW/SnP/2JqZoWLVrEn7ErJnZf5qS6ujrXxcgbwwWiTIkoS030tJYacvSk7JO8QqHgtz+M1qxZ84vvBT6Q/vrXv+5hE3fs2EGCIN+wxHiJVPmUlsxzVJTsCXr22Wf54k1NTbR3715asmQJZWVl0eHDh11g8/PzuUkxYjcxmzZt4hv5hIQEGaQA2hoLopkiGaeJNFTff0iwfft2Pu/YsWOH7jad7yV2bHH8+PFDbAEmUacmPCTQBG9wx2WnGPcjp7Tr6+u59I8cOUIvvPACBz5u3DhaunQp7weeaGQEgDylfskzgTBiPqnVatX/HPo+0mg0ypMnT+Y7JanX6+Ujl/h4amlpuS/4gZIPDQ0ld3d3CgsLo/T0dHrxxRf5NezmzZvJ39//vvdm7OqKMcyoqKioQK/Xu30Xxu/VC1Pd/v37d2VlZS1kuY41VjK0trbyGxUW59kegv3PnJOVDywLszKBnTqwssLLy4vXQyxPsFqebUX37Nlzz7eY87PLlNDQULz//vvvrVixYo3FYrHdF9gPJSYBo9FYzhyVHSyxm0WmAV9f33ukx3zF29ubAgICeLyPioritj5x4kR6/PHHacGCBfz+mJnIwHlsLWbvzPTYBd/ChQuz/i3QA2n9+vWrmTqZWplzOu2e9ezy2mAw3NcUfkhjDG7bts11m8+ucdl17gMDz2jbtm1vOa8+jx49enDFihVLZs2aNYX9ttvtVnbRzcLtqlWraNSoUaRUKv9XwGxs9OjR3KFZ+O27ubcXFBR8OmnSpDH/Cr7v9QFRFAUfHx93drVjt9sH7axDQkL8s7Ozfzpnzpw5KSkp49ltJiudmV+w44+uri7uC+7u7jwhsZqo70zIUVpaeiEvLy9v7969+4xGY92/Av4HMfBDyc/PzyMtLS01Pj4+wWAwGIKCgoLc3Nx0TADd3d3dTU1NjUaj0Xj16tWrxcXFFxobG9sfxHf/Bxoc4AU61vbkAAAAAElFTkSuQmCC" + "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAScElEQVR4nM1ZCXhUVZb+36tXlUpVZd/NWlmAhM4GCWERWVxQcExAIdCTuCAEaAUbAUU+GGwcsVtE5ZOMLNINTT5pUQggyGITCEgnSEhkEUzSxnRCyL5WUlRqO/Pd+6qKBB3ttumZOd9369Zb7n1nP+eeA9xl0Ov194SFhQXgfwmEu7VRbGxs5IcffrgrPT19gt1ut73xxhv/UV9f3zhixIjUoKCgoIaGhobCwsL9RUVFX9jtdvy/gdjY2PCVK1cubWhoqK2rq6O1a9dSeXk5MbBardTX10cDwWw2G0tLS0+vWbNmRXx8vP7/BGlRFPH4449PLSoqOsLwZIj19vZSVFQURQUqKSUlhXJycsjd3Z0A0JAhQyg/P59sNtsgYojIdu7cuZM5OTmPS5J017ThR2HmzJmPVlVVXXFhYLPRuXPnaM6cOZQxREPn303gSD/1oD/9df9D1HVwDK2eFcDvaTQaysjIoJdffplKSkoGUVJbW1vJCPmXIR4cHOx34MCBD50fZBzftGkTRUdHc+TYeDDVk+jsI7TqCX+ynnqAzJ+m0TOTvUklCa53Bo64uDi+h8FgcBFy7NixwrCwsKC7ivz9998/rqOjo9mhw7Rx40by9PQchMzQUBW98G9+1PGnZKJjo4n+PF4en99LdCyDDHsTqfh1Pa2eGUDDw90GrfXy8uKEWCwWTkRPT09HZmbmlLuC/MKFC3MtFouJbVxVVUWpqamDPj4pUUun/jOa6OR9RF9mEV3JJbr6JFFFNtHXT90e7N5Xs4nOPcIJ+uINPU0f7TFor/T0dKqpqXEKw7pq1aol/xTyL774Yp5zt8LCQq7DLq5pRCpYGkb0aQrRibFEx0fLSDOOH0wkOjWJ6NIviYofIDqaTnQ+czBBF2cSnRhDZRtjKFWvdu2r0+no8OHDLpVau3btsh/D8X+0/Dlz5mQVFBR8IoqiYs+ePcjNzYXNZuPPkqPccHBVJCIDVQN2EgBBBOzyO3DTAJZ+x7UAePoCRgNABNwTA6i18n9DB/ob6/Cr/Dr8/mQXXypJEnbv3o3Zs2ezS/uCBQue2rZtW8HfTcCIESOGl5SUXFCpVO47duxAXl4enMEnc5QH9iwPh7tKxM8CpZtMqM0KqNRAYCTzy0BDNTZ8VIeXdjU7+CFg+/btePbZZxnjzJMmTRp39uzZsp8kQKvVqisqKsri4uKGnz59mhmwC/nJiVocWxsF5d1y2R6+gFcAICoASQXcrMavN1dj0+EOlyQYDuPGjcONGzdqkpKSkjs7O3sHbvE9Nr711luvM+QbGhrwxBNPuJAfHu6GA6si7h7yDAwdwI1KoO4aYGgHQuOwcaEekxI1/LHVasWMGTPQ1NSEsLCw6Pfee++dO7cYhM3QoUOjrl69WilJkmratGn47LPPZCoFoPztGCRHqQcvvZux090D8AkGJCW+vXAJwxZVwupImaZPn479+/ezv/a0tLSkixcvfv2DEli3bt2rDPkTJ064kGew6CEfJIeqAIsdsBJgY8MuDzvJgwaOn0HALQNXIXS3IiYhEnlTfF2PCgsLUVxczPHdsGHDWwOXuXgYHR0dWllZWcMIyMjIwJdffsnvqxRAzbvRCPVRym9zbzNgpfN64P+B14O+4rhwXhOBMVl0vucED1/U1LQhNu8a5weDe++9F2fPnuX/R48enXL+/PlLnCLnmiVLlix2ct+JPIPZGR4I1Yoy99kw27CzqBNJK2rg8VQlQvKq8KttjejqtgIWm+Mdx7sDB9MHh+S+qTfh4d/Uwn3WNage/xoJz1dj77nu25IzdCA6RI2JwzXQuglchb/44gunFPD8888/78RPdLqsnJycXPZ/69at/IFGJXMle6R2ECIr9rTi1RNqTMleAr/gCDR12/D+n7sw7tW/yUQMRN7sIMh1bcfV725h/Oo6xE+Yh/sfmsq18PqNfmRvqMe7n7bdVktzP6ak6mDsJ6ToZdtz4jZ9+vQnVCqV5OJyenp6Iot6RqOR3NzkPCUxRMnnvrcjiDZHEeVH0cVX7uH3nJlkaWnpoFRg0URPog9iiHbEyuP3sUR/iCPa6Ri74mhMrJoWLVrkirRBQUGu9ZIC1LQ1juhPw4g+iqeitRH8fu59XnxWq9VkMvGshlh+5pLApEmTJrGZiai/vx9KEQjxEBGoE8EdmoOD+8pkF1xfXz9odsIn7PmdqsPUyiGVHoMV5781oaamhr/f1tYGg8HgWm+1AccuGlxr9b4yk8N9FFAqAJPJ5LKDiRMnTnQRkJaWNorNZ86c4Q9/ESzBaCb4axy6zxAw29HcbYO/vz9LM5CamuoM9S5o7XW+O0B1BqhUZ7eVa8fx48cRGRmJmJgYGI1G1/qAgAC0c1uSCfdWyvf7++1IDHPj/0+dOuXUmlEuAoYNGzaMzZcuccPGMD8JLIMn5gIGcDPaWwTzUCwn+uqrr1y5kROifBQ/IAGHFCx23KMRoHZobl1dHXp6egatZ3sP8b+9h40Rz5AkYFiwTE15eTkG4swJiIyMjGBzdXU1fxjpKcJbBTT33v643WyHWuDvYsiQIbgTWNhflCEb/HfNFuQWtOEXbzYicUMj5u9px812C5Q2wjOjtFAqHawdAJMnT4ZSEmEy3ZZca4eFP/NyExDpI1NeWVnJ59DQ0EiFQgGJbebpyVJF8JDNwF8lIMJDxKe3CF0GG7zVzJUJeDxOhcx9O/Dkc2vQ1dXFVY5totFoEGq4gqUZIk5X38LiPxvw9uu52PXQNJDViMMHCvDA+iLszPLGmw97oc2mQI93Ajo7O+Hm5sbzrfb2dtw49QGmjvaT1U6QvRODME8R7X2yNBobG/ksSZKbl5eXVtDpdEqDwWB2HtaZ2uRP1kAlCZh/og97HtVhdrybKwAxV/7pt2b8pUMLZWAMTJ1NGKVtQfZwNS61WpHzmQGfbxqJ4BCGSDXAcidtHP5WV4NHn6/GoZk+iPRW4KMrt1BN4VBpPUGtf8UjMXak3KMaFCyXHOzCji97cTwvEFeaLPjVvk6OvMVi4RIPCQnxl6wsY3IAiweMALuVkOArIkAt4A+XTZgdczsKKwQgK0pClt4MCNeBSLZShfIbZjx51IC9SwPw9q5reP3ffaB0EwGlAHPPdWze04Htq0Iw/bWb2DvDG3MSWFrdykwfiGYIS7LqOL5jJcL+K0ZkhKsg2QnkTIwGADu1ScyvmkymbrVa7aXT6bhh9fXbIdpETI+WsO2aBX+5YcHYYMXg1EAQUNVlw75vLShrtqLBRDgw1xuBoh3NTWYIXRaAnRmUAhQKAY03zBjmLWDXqmDMeqsFwzQCUoIkzB6uRpS34naK4RgFl0xo6LFj2Vg3HsV7b8kEuLu7c+4DsHV2dhq4ETc2NnLlDwqSiwH9jtD/RKQEnQQsKTbC2j/Ys9wy2TC10ADJYsWykUqU5nggNiwenv5J2JWXDkmKBIRwQIyEQopBwUv3wdsvDcn6GFx8MwTzMz1hNFjw4O5O2ds40xCLHX1GG1afNCDCU8SoIIknkK0G2eMFBwfzuaOjo8VsNts5KVVVVZV6vX5oXFwc90Q3DXZoHInJykQlVldY8MIXt5A/hold5pRolxlc22GHymLGrXYrwqovQu3jB8nvHkiePhDc1GD+mCxG2PqaYelugrGrBzVNFnzdbOMc1jHtHKA6jM9zDxs4DvkPaqFgRmcntPXKBAwdOhROnLkxs5+KioqKKVOmPJaSksLT6NJWO95MJlzrJ9wfIKBaL+K/vrHy2LApXQWFCDCzPvuIO9ZfNuPN5kDo+nTo62iFtr8B/m4N8JQESKKcXTMG91gIbRYBJo0fvPwiuCuNxtc4M0ML0UEAy9TnFxmxt9KM55LckOqn4JoQoBVxqVk21REjRvC5vLy8wkVAcXFx8cqVK1l4xvr163Gpi2A12xEiAY0mYIFeAbID+ZVWXGi1IT9diTRfEX4ikBUqojxwCD/0OwwLfX19fLDQz9wsc5VarRZqtVoOjgC++eYbtBz6GlrGc4uAU41WLD1nwqV2OxYkKJETp+TIs3TeSxDwVYssAeZynTg7zZH5cVVnZ2eX3W539/Hx4R/enixibqSIqwaCkRcWBBS12vG7Kjt6rMAYPwEdZsBDCURMnM5KMK5DEAuSDGGW8xw5coS7PZYmMPEzKefn5+PcuXOcmDCNgAB3ARXtdvi5Aa8kqzAuWHIZc4KvAp/UWPDsaROPNyx2SJJkCwoK8mtra+vmEjAajeajR48ezMzMnM2Okvv27cP739kxLxSIVwNXDICZCJN8gC/9BZzsEvDIZF+MDlfh8AUDPjxzBlu2bOFIMsTYqK2t5URMnTqVH8q9vLxw/fp1/p7YUY66D4Yg2FvCsXIDNh5sg9BuxMKhSozzF+WzgyAgykOAJxG2XOVhCllZWVCpVCyAnmTI89jl9KnbWQ0DwPz582Ud6wGKWonnIdyy7MC+m3acNylwfn0U1jzsDaHfhqXp7jyrZHnRzp07eaLGCFm+fDneeecdzvVDhw7htdde44Hy9KkifPhsIIKUBMlux6MjPXDqNT12vRCKTVVWHKy1ysZgtcMDhNMNFlxok13ovHnz+Lxz584/uGLXwMBQXl5ekpqaOnrUqFG4cOECUjyAI2kC6kwCGk2EOZcIxeuikMFiQo8FnS39GLetFd90Elc7xh1nms3S3pKSEk4cy2DHjx+PpKQkJA6Px5J7dXgsSYMJw7WAm0I+t6pEXKjtx32rapCfokCClwgvlYDcUgsudhLGjh3LJVtfX/9tbGzsULOZpbx3QGZm5kPssPD555+7Dhkv6UElY0SaFQzKGqmTDyxvR1DpfD96aZQ7/TJOSaNHj6aysjLau3cv3bx5884eALW0tNC+ffuovr6eQkNDKT1YQfVL/OjIk75EvwslejeC6H09PwC98JA3jfcDlUyQ6JWhXP58nD59mu81d+7cOfgxOHPmzHH2YlZWlnxKEkDbfyGQjwQ6/kII0cZworXBREt9afdEuaZZUFDAy+3Hjx+nNWvW8F5Bbm4ur2I3NDQMIuaTTz4hrVKgADXoxtOeRMt8iVYFEP0mmOi3oXR5RTD/5s5kgdxEGflZs2bxtUxDWLozEL5X2UlISIgpKyv7qru7W5ecnIyWlhZ4SYCRgJ71YVAbLbhea8LSk71QEqHWJ4HFEW477DQXHx/PjXbkyJE89WVebdmyZbh27RpXM4ZAc3MzdIIFLyVIuNxN+GCiOzRaiauTVSVC/dtW6BQAO9uEhITwc4q3t3f/2LFj08rKyq7ip2DBggU5jOLi4mISRVmMPu4CNS0LIPq1D9FcHa1PVPD7Z8+epZMnT/LqdWdnJ3333Xf0xz/+kYma5s2bx++xFhPrlzmhsbHR1Rh5Y5hAlCURZbsRPamh5lwdKR2cVygUvPvDYMWKFc/hH4GPP/54F1u4detWEgS5wxLnLVLNTA2ZZqgo1Qv09NNP881bW1tp9+7dlJeXR9nZ2XTo0CEXsgcOHOAqxYB1YtatW8cP8klJSTKSAmhTPIgeEan2fpGG6G4XCbZs2cLXHT16dP+dqvOTwMoWx44d2882YBx1SsJTAo3zATdcVsX4IXByu6mpiXOf1ftffPFFjviYMWNo4cKFfMaAikZmIMhLus15xhAGzCY1Go18IP5HQa1WK0+cOHHAyUnWfOAll8REam9v/0HkB3I+PDycPDw8KCIigqZOnUrLly/nbdj169dTQIDc+MMdg7WunA2OkpKSIp1O5/5jOP6kXJjo9uzZsyM7O3sui3VssJSho6MDN2/e5H6enSHYNTNOlj6wKMzSBFZ1YGmFt7c3z4dYnGC5PDuK7tq163vfYsbPminh4eHYtm3bu4sXL15hNptdB66fBYwDtbW1VcxQWWGJdRaZBPz8/L7HPWYrPj4+FBgYyP19TEwM1/Xx48fTY489Rs888wzvHzMVGbjOz8+P6ztTPdbgmzt3bjbuFqxevXoZEycTKzNOp96zmTWv9Xr9D6rC3zNiYmJo8+bNrm4+a+Oydi7uJmzevHkD25xx5siRI/sWL16cN23atEnsv81ms7BGN3O3S5cupREjRpBSKZckf2iwZyNHjuQGzdyvTe7c24qKij6bMGECL1T9o/CTNiCKouDr6+vBWjs2G6u83obQ0NCAnJycX86YMWNGWlraWFEUJZY6M7tg5Y/e3l5uCx4eHjwgsZzIUROyV1RUnC8sLCzcvXt3QW1trVwr+VcQ8PeCv7+/Z0ZGRnpiYmKSXq/XBwcHB7u7u2sZA/r6+vpaW1tbamtray9fvny5tLT0fEtLi9yS/CfhvwEPv/IpB1dpMAAAAABJRU5ErkJggg==" }, "annotations": [] } diff --git a/tests/data/docx/groundtruth/docx_rich_cells.docx.md b/tests/data/docx/groundtruth/docx_rich_cells.docx.md index 2f6760c9a4..7ba6fbe88c 100644 --- a/tests/data/docx/groundtruth/docx_rich_cells.docx.md +++ b/tests/data/docx/groundtruth/docx_rich_cells.docx.md @@ -3,7 +3,7 @@ | Column A | Column B | | - | - | | This is a list: - A First - A Second - A Third | This is a formatted list: - B **First** - B *Second* - B Third | -| First Paragraph Second Paragraph Third paragraph before a numbered list 1. Number one 2. Number two 3. Number three | This is simple text with **bold** , ~~strikethrough~~ and *italic* formatting with x 2 and H 2 O | +| First Paragraph Second Paragraph Third paragraph before a numbered list 1. Number one 2. Number two 3. Number three | This is simple text with **bold** , ~~strikethrough~~ and *italic* formatting with x 2 and H 2 O | | This is a paragraph This is another paragraph | | ### Table with nested table @@ -12,7 +12,7 @@ Before table | Column A | Column B | | - | - | -| Simple cell upper left | Simple cell with **bold** and *italic* text | +| Simple cell upper left | Simple cell with **bold** and *italic* text | | A B C Cell 1 Cell 2 Cell 3 | Rich cell A nested table A B C Cell 1 Cell 2 Cell 3 | After table with **bold** , underline , ~~strikethrough~~ , and *italic* formatting diff --git a/tests/data/jats/groundtruth/elife-56337.nxml.itxt b/tests/data/jats/groundtruth/elife-56337.nxml.itxt index 55ea8c7fb7..9ad4fcd81a 100644 --- a/tests/data/jats/groundtruth/elife-56337.nxml.itxt +++ b/tests/data/jats/groundtruth/elife-56337.nxml.itxt @@ -62,203 +62,238 @@ item-0 at level 0: unspecified: group _root_ item-56 at level 2: section_header: Materials and methods item-57 at level 3: table with [31x5] item-57 at level 4: caption: Key resources table - item-58 at level 3: section_header: Cell lines and transgenic mice - item-59 at level 4: inline: group group - item-60 at level 5: text: Mouse ES cells and F9 EC cells w ... nes originate from JM8A3.N1 C57BL/6N-A - item-61 at level 5: text: tm1Brd - item-62 at level 5: text: ES cells (KOMP Repository). Chr2 ... KO/KO and KO/WT (B6/129 F2) offspring. - item-63 at level 3: section_header: Generation of KRAB-ZFP expressing cell lines - item-64 at level 4: inline: group group - item-65 at level 5: text: KRAB-ZFP ORFs were PCR-amplified ... r 3XHA tags in F9 EC or ES cells using - item-66 at level 5: text: Sleeping beauty - item-67 at level 5: text: transposon-based (Wolf et al., 2 ... led and further expanded for ChIP-seq. - item-68 at level 3: section_header: CRISPR/Cas9 mediated deletion of KRAB-ZFP clusters and an MMETn insertion - item-69 at level 4: inline: group group - item-70 at level 5: text: All gRNAs were expressed from th ... -Chimeric_BB-CBh-hSpCas9 vector (RRID: - item-71 at level 5: text: Addgene_42230 - item-72 at level 5: text: ) and nucleofected into 10 - item-73 at level 5: text: 6 - item-74 at level 5: text: ES cells using Amaxa nucleofecti ... PCR genotyping (Supplementary file 3). - item-75 at level 3: section_header: ChIP-seq analysis - item-76 at level 4: inline: group group - item-77 at level 5: text: For ChIP-seq analysis of KRAB-ZFP expressing cells, 5–10 × 10 - item-78 at level 5: text: 7 - item-79 at level 5: text: cells were crosslinked and immun ... -FLAG (Sigma-Aldrich Cat# F1804, RRID: - item-80 at level 5: text: AB_262044 - item-81 at level 5: text: ) or anti-HA (Abcam Cat# ab9110, RRID: - item-82 at level 5: text: AB_307019 - item-83 at level 5: text: or Covance Cat# MMS-101P-200, RRID: - item-84 at level 5: text: AB_10064068 - item-85 at level 5: text: ) antibody using one of two prev ... serum (Active Motif Cat# 39161, RRID: - item-86 at level 5: text: AB_2532132 - item-87 at level 5: text: ) as described previously (Karim ... Fisher Scientific Cat# A-11122, RRID: - item-88 at level 5: text: AB_221569 - item-89 at level 5: text: ) using a previously described p ... inst H3K4me3 (Abcam Cat# ab8580, RRID: - item-90 at level 5: text: AB_306649 - item-91 at level 5: text: ), H3K4me1 (Abcam Cat# ab8895, RRID: - item-92 at level 5: text: AB_306847 - item-93 at level 5: text: ) and H3K27ac (Abcam Cat# ab4729, RRID: - item-94 at level 5: text: AB_2118291 - item-95 at level 5: text: ) following the protocol develop ... 010 or Khil et al., 2012 respectively. - item-96 at level 4: inline: group group - item-97 at level 5: text: ChIP-seq libraries were construc ... to the mm9 genome using Bowtie (RRID: - item-98 at level 5: text: SCR_005476 - item-99 at level 5: text: ; settings: --best) or Bowtie2 ( ... Peaks were called using MACS14 (RRID: - item-100 at level 5: text: SCR_013291 - item-101 at level 5: text: ) under high stringency settings ... element in UCSC Genome Browser (RRID: - item-102 at level 5: text: SCR_005780 - item-103 at level 5: text: ) were calculated by using the b ... ettings: -f 0.25) from BEDTools (RRID: - item-104 at level 5: text: SCR_006646 - item-105 at level 5: text: ). The right-tailed p-values bet ... were re-mapped using Bowtie (--best). - item-106 at level 3: section_header: Luciferase reporter assays - item-107 at level 4: inline: group group - item-108 at level 5: text: For KRAB-ZFP repression assays, ... y of the MMETn element upstream of the - item-109 at level 5: text: Cd59a - item-110 at level 5: text: gene, fragments of varying sizes ... after transfection as described above. - item-111 at level 3: section_header: RNA-seq analysis - item-112 at level 4: inline: group group - item-113 at level 5: text: Whole RNA was purified using RNe ... reads on an Illumina HiSeq2500 (RRID: - item-114 at level 5: text: SCR_016383 - item-115 at level 5: text: ) or HiSeq3000 (RRID: - item-116 at level 5: text: SCR_016386 - item-117 at level 5: text: ) machine (Supplementary file 4) ... mouse genome (mm9) using Tophat (RRID: - item-118 at level 5: text: SCR_013035 - item-119 at level 5: text: ; settings: --I 200000 g 1) unle ... h TEs annotated in Repeatmasker (RRID: - item-120 at level 5: text: SCR_012954 - item-121 at level 5: text: ) were counted using BEDTools Mu ... expression analysis with DESeq2 (RRID: - item-122 at level 5: text: SCR_015687 - item-123 at level 5: text: ). For differential gene express ... function of BED tools. The probability - item-124 at level 5: text: p - item-125 at level 5: text: in the binomial distribution was ... apped with KRAB-ZFP peaks. Then, given - item-126 at level 5: text: n - item-127 at level 5: text: which is the number of specific groups of genes, and - item-128 at level 5: text: x - item-129 at level 5: text: which is the number of this grou ... lemented in the R function p.adjust(). - item-130 at level 3: section_header: Reduced representation bisulfite sequencing (RRBS-seq) - item-131 at level 4: text: For RRBS-seq analysis, Chr4-cl W ... h sample were considered for analysis. - item-132 at level 3: section_header: Retrotransposition assay - item-133 at level 4: inline: group group - item-134 at level 5: text: The retrotransposition vectors p ... MusD retrotransposition assays, 5 × 10 - item-135 at level 5: text: 4 - item-136 at level 5: text: HeLa cells (ATCC CCL-2) were tra ... were stained with Amido Black (Sigma). - item-137 at level 3: section_header: Capture-seq screen - item-138 at level 4: inline: group group - item-139 at level 5: text: To identify novel retrotransposo ... target enrichment using the SureSelect - item-140 at level 5: text: QXT - item-141 at level 5: text: Target Enrichment kit (Agilent). ... assembly using the Unicycler software. - item-142 at level 2: section_header: Funding Information - item-143 at level 3: text: This paper was supported by the following grants: - item-144 at level 3: list: group list - item-145 at level 4: list_item: http://dx.doi.org/10.13039/10000 ... ment 1ZIAHD008933 to Todd S Macfarlan. - item-146 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... ndation 310030_152879 to Didier Trono. - item-147 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... dation 310030B_173337 to Didier Trono. - item-148 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... ch Council No. 268721 to Didier Trono. - item-149 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... rch Council No 694658 to Didier Trono. - item-150 at level 2: section_header: Acknowledgements - item-151 at level 3: text: We thank Alex Grinberg, Jeanne Y ... 268721; Transpos-X, No. 694658) (DT). - item-152 at level 2: section_header: Additional information - item-153 at level 3: section_header: Competing interests - item-154 at level 4: list: group footnotes - item-155 at level 5: list_item: - item-156 at level 6: footnote: No competing interests declared. - item-157 at level 3: section_header: Author contributions - item-158 at level 4: list: group footnotes - item-159 at level 5: list_item: - item-160 at level 6: footnote: Conceptualization, Data curation ... Methodology, Writing - original draft. - item-161 at level 5: list_item: - item-162 at level 6: footnote: Conceptualization, Data curation ... l draft, Writing - review and editing. - item-163 at level 5: list_item: - item-164 at level 6: footnote: Conceptualization, Data curation ... odology, Writing - review and editing. - item-165 at level 5: list_item: - item-166 at level 6: footnote: Conceptualization, Formal analys ... igation, Writing - review and editing. - item-167 at level 5: list_item: - item-168 at level 6: footnote: Investigation. - item-169 at level 5: list_item: - item-170 at level 6: footnote: Investigation. - item-171 at level 5: list_item: - item-172 at level 6: footnote: Data curation, Software, Formal analysis, Visualization. - item-173 at level 5: list_item: - item-174 at level 6: footnote: Investigation. - item-175 at level 5: list_item: - item-176 at level 6: footnote: Conceptualization, Resources, Su ... igation, Writing - review and editing. - item-177 at level 5: list_item: - item-178 at level 6: footnote: Conceptualization, Resources, Su ... tration, Writing - review and editing. - item-179 at level 3: section_header: Ethics - item-180 at level 4: list: group footnotes - item-181 at level 5: list_item: - item-182 at level 6: footnote: Animal experimentation: All stud ... er IACUC animal protocol (ASP )18-026. - item-183 at level 2: section_header: Additional files - item-184 at level 2: section_header: Data availability - item-185 at level 3: text: All NGS data has been deposited ... GenBank database (MH449667- MH449669). - item-186 at level 3: text: The following datasets were generated: - item-187 at level 3: text: Wolf G. Retrotransposon reactiva ... ession Omnibus (2019). NCBI: GSE115291 - item-188 at level 3: text: Wolf G. Mus musculus musculus st ... e. NCBI GenBank (2019). NCBI: MH449667 - item-189 at level 3: text: Wolf G. Mus musculus musculus st ... e. NCBI GenBank (2019). NCBI: MH449668 - item-190 at level 3: text: Wolf G. Mus musculus musculus st ... e. NCBI GenBank (2019). NCBI: MH449669 - item-191 at level 3: text: The following previously published datasets were used: - item-192 at level 3: text: Castro-Diaz N, Ecco G, Coluccio ... ssion Omnibus (2014). NCBI: GSM1406445 - item-193 at level 3: text: Andrew ZX. H3K9me3_ChIPSeq (Ctrl ... ssion Omnibus (2014). NCBI: GSM1327148 - item-194 at level 2: section_header: References - item-195 at level 3: list: group list - item-196 at level 4: list_item: Bailey TL, Boden M, Buske FA, Fr ... OI: 10.1093/nar/gkp335, PMID: 19458158 - item-197 at level 4: list_item: Baust C, Gagnier L, Baillie GJ, ... 77.21.11448-11458.2003, PMID: 14557630 - item-198 at level 4: list_item: Blaschke K, Ebata KT, Karimi MM, ... I: 10.1038/nature12362, PMID: 23812591 - item-199 at level 4: list_item: Brodziak A, Ziółko E, Muc-Wierzg ... I: 10.12659/msm.882892, PMID: 22648263 - item-200 at level 4: list_item: Castro-Diaz N, Ecco G, Coluccio ... 10.1101/gad.241661.114, PMID: 24939876 - item-201 at level 4: list_item: Chuong EB, Elde NC, Feschotte C. ... 0.1126/science.aad5497, PMID: 26941318 - item-202 at level 4: list_item: Dan J, Liu Y, Liu N, Chiourea M, ... 6/j.devcel.2014.03.004, PMID: 24735877 - item-203 at level 4: list_item: De Iaco A, Planet E, Coluccio A, ... . DOI: 10.1038/ng.3858, PMID: 28459456 - item-204 at level 4: list_item: Deniz Ö, de la Rica L, Cheng KCL ... 1186/s13059-017-1376-y, PMID: 29351814 - item-205 at level 4: list_item: Dewannieux M, Heidmann T. Endoge ... 6/j.coviro.2013.08.005, PMID: 24004725 - item-206 at level 4: list_item: Ecco G, Cassano M, Kauzlaric A, ... 6/j.devcel.2016.02.024, PMID: 27003935 - item-207 at level 4: list_item: Ecco G, Imbeault M, Trono D. KRA ... OI: 10.1242/dev.132605, PMID: 28765213 - item-208 at level 4: list_item: Frank JA, Feschotte C. Co-option ... 6/j.coviro.2017.07.021, PMID: 28818736 - item-209 at level 4: list_item: Gagnier L, Belancio VP, Mager DL ... 1186/s13100-019-0157-4, PMID: 31011371 - item-210 at level 4: list_item: Groner AC, Meylan S, Ciuffi A, Z ... 1/journal.pgen.1000869, PMID: 20221260 - item-211 at level 4: list_item: Hancks DC, Kazazian HH. Roles fo ... 1186/s13100-016-0065-9, PMID: 27158268 - item-212 at level 4: list_item: Imbeault M, Helleboid PY, Trono ... I: 10.1038/nature21683, PMID: 28273063 - item-213 at level 4: list_item: Jacobs FM, Greenberg D, Nguyen N ... I: 10.1038/nature13760, PMID: 25274305 - item-214 at level 4: list_item: Kano H, Kurahashi H, Toda T. Gen ... 0.1073/pnas.0705483104, PMID: 17984064 - item-215 at level 4: list_item: Karimi MM, Goyal P, Maksakova IA ... 016/j.stem.2011.04.004, PMID: 21624812 - item-216 at level 4: list_item: Kauzlaric A, Ecco G, Cassano M, ... 1/journal.pone.0173746, PMID: 28334004 - item-217 at level 4: list_item: Khil PP, Smagulova F, Brick KM, ... 10.1101/gr.130583.111, PMID: 22367190 - item-218 at level 4: list_item: Krueger F, Andrews SR. Bismark: ... /bioinformatics/btr167, PMID: 21493656 - item-219 at level 4: list_item: Langmead B, Salzberg SL. Fast ga ... OI: 10.1038/nmeth.1923, PMID: 22388286 - item-220 at level 4: list_item: Legiewicz M, Zolotukhin AS, Pilk ... 0.1074/jbc.M110.182840, PMID: 20978285 - item-221 at level 4: list_item: Lehoczky JA, Thomas PE, Patrie K ... 1/journal.pgen.1003967, PMID: 24339789 - item-222 at level 4: list_item: Leung D, Du T, Wagner U, Xie W, ... 0.1073/pnas.1322273111, PMID: 24757056 - item-223 at level 4: list_item: Lilue J, Doran AG, Fiddes IT, Ab ... 1038/s41588-018-0223-8, PMID: 30275530 - item-224 at level 4: list_item: Liu S, Brind'Amour J, Karimi MM, ... 10.1101/gad.244848.114, PMID: 25228647 - item-225 at level 4: list_item: Love MI, Huber W, Anders S. Mode ... 1186/s13059-014-0550-8, PMID: 25516281 - item-226 at level 4: list_item: Lugani F, Arora R, Papeta N, Pat ... 1/journal.pgen.1003206, PMID: 23437001 - item-227 at level 4: list_item: Macfarlan TS, Gifford WD, Drisco ... I: 10.1038/nature11244, PMID: 22722858 - item-228 at level 4: list_item: Maksakova IA, Romanish MT, Gagni ... 1/journal.pgen.0020002, PMID: 16440055 - item-229 at level 4: list_item: Matsui T, Leung D, Miyashita H, ... I: 10.1038/nature08858, PMID: 20164836 - item-230 at level 4: list_item: Najafabadi HS, Mnaimneh S, Schmi ... DOI: 10.1038/nbt.3128, PMID: 25690854 - item-231 at level 4: list_item: Nellåker C, Keane TM, Yalcin B, ... .1186/gb-2012-13-6-r45, PMID: 22703977 - item-232 at level 4: list_item: O'Geen H, Frietze S, Farnham PJ. ... 7/978-1-60761-753-2_27, PMID: 20680851 - item-233 at level 4: list_item: Patel A, Yang P, Tinkham M, Prad ... 016/j.cell.2018.02.058, PMID: 29551271 - item-234 at level 4: list_item: Ribet D, Dewannieux M, Heidmann ... OI: 10.1101/gr.2924904, PMID: 15479948 - item-235 at level 4: list_item: Richardson SR, Gerdes P, Gerhard ... 10.1101/gr.219022.116, PMID: 28483779 - item-236 at level 4: list_item: Rowe HM, Jakobsson J, Mesnard D, ... I: 10.1038/nature08674, PMID: 20075919 - item-237 at level 4: list_item: Rowe HM, Kapopoulou A, Corsinott ... 10.1101/gr.147678.112, PMID: 23233547 - item-238 at level 4: list_item: Schauer SN, Carreira PE, Shukla ... 10.1101/gr.226993.117, PMID: 29643204 - item-239 at level 4: list_item: Schultz DC, Ayyanathan K, Negore ... OI: 10.1101/gad.973302, PMID: 11959841 - item-240 at level 4: list_item: Semba K, Araki K, Matsumoto K, S ... 1/journal.pgen.1003204, PMID: 23436999 - item-241 at level 4: list_item: Sripathy SP, Stevens J, Schultz ... : 10.1128/MCB.00487-06, PMID: 16954381 - item-242 at level 4: list_item: Thomas JH, Schneider S. Coevolut ... 10.1101/gr.121749.111, PMID: 21784874 - item-243 at level 4: list_item: Thompson PJ, Macfarlan TS, Lorin ... 6/j.molcel.2016.03.029, PMID: 27259207 - item-244 at level 4: list_item: Treger RS, Pope SD, Kong Y, Toku ... 6/j.immuni.2018.12.022, PMID: 30709743 - item-245 at level 4: list_item: Vlangos CN, Siuniak AN, Robinson ... 1/journal.pgen.1003205, PMID: 23437000 - item-246 at level 4: list_item: Wang J, Xie G, Singh M, Ghanbari ... I: 10.1038/nature13804, PMID: 25317556 - item-247 at level 4: list_item: Wolf D, Hug K, Goff SP. TRIM28 m ... 0.1073/pnas.0805540105, PMID: 18713861 - item-248 at level 4: list_item: Wolf G, Greenberg D, Macfarlan T ... 1186/s13100-015-0050-8, PMID: 26435754 - item-249 at level 4: list_item: Wolf G, Yang P, Füchtbauer AC, F ... 10.1101/gad.252767.114, PMID: 25737282 - item-250 at level 4: list_item: Yamauchi M, Freitag B, Khan C, B ... JVI.69.2.1142-1149.1995, PMID: 7529329 - item-251 at level 4: list_item: Zhang Y, Liu T, Meyer CA, Eeckho ... .1186/gb-2008-9-9-r137, PMID: 18798982 - item-252 at level 1: caption: Figure 1. Genome-wide binding pa ... onsensus fingers highlighted in white. - item-253 at level 1: caption: Table 1. KRAB-ZFP genes clusters ... ChIP-seq was performed in this study. - item-254 at level 1: caption: Figure 2. Retrotransposon reacti ... s were calculated using paired t-test. - item-255 at level 1: caption: Figure 3. TE-dependent gene acti ... Gm13051 are indicated by dashed lines. - item-256 at level 1: caption: Figure 4. ETn retrotransposition ... combined for the statistical analysis. - item-257 at level 1: caption: Key resources table \ No newline at end of file + item-58 at level 4: unspecified: group rich_cell_group_2_4_7 + item-59 at level 5: inline: group group + item-60 at level 6: text: ChIP (1 µg/10 + item-61 at level 6: text: 7 + item-62 at level 6: text: cells) + item-63 at level 4: unspecified: group rich_cell_group_2_4_8 + item-64 at level 5: inline: group group + item-65 at level 6: text: ChIP (1 µg/10 + item-66 at level 6: text: 7 + item-67 at level 6: text: cells) + item-68 at level 4: unspecified: group rich_cell_group_2_4_10 + item-69 at level 5: inline: group group + item-70 at level 6: text: ChIP (3 µl/10 + item-71 at level 6: text: 7 + item-72 at level 6: text: cells) + item-73 at level 4: unspecified: group rich_cell_group_2_4_11 + item-74 at level 5: inline: group group + item-75 at level 6: text: ChIP (1 µg/10 + item-76 at level 6: text: 7 + item-77 at level 6: text: cells) + item-78 at level 4: unspecified: group rich_cell_group_2_4_12 + item-79 at level 5: inline: group group + item-80 at level 6: text: ChIP (1 µg/10 + item-81 at level 6: text: 7 + item-82 at level 6: text: cells) + item-83 at level 4: unspecified: group rich_cell_group_2_4_13 + item-84 at level 5: inline: group group + item-85 at level 6: text: ChIP (1 µg/10 + item-86 at level 6: text: 7 + item-87 at level 6: text: cells) + item-88 at level 4: unspecified: group rich_cell_group_2_4_14 + item-89 at level 5: inline: group group + item-90 at level 6: text: ChIP (1 µg/10 + item-91 at level 6: text: 7 + item-92 at level 6: text: cells) + item-93 at level 3: section_header: Cell lines and transgenic mice + item-94 at level 4: inline: group group + item-95 at level 5: text: Mouse ES cells and F9 EC cells w ... nes originate from JM8A3.N1 C57BL/6N-A + item-96 at level 5: text: tm1Brd + item-97 at level 5: text: ES cells (KOMP Repository). Chr2 ... KO/KO and KO/WT (B6/129 F2) offspring. + item-98 at level 3: section_header: Generation of KRAB-ZFP expressing cell lines + item-99 at level 4: inline: group group + item-100 at level 5: text: KRAB-ZFP ORFs were PCR-amplified ... r 3XHA tags in F9 EC or ES cells using + item-101 at level 5: text: Sleeping beauty + item-102 at level 5: text: transposon-based (Wolf et al., 2 ... led and further expanded for ChIP-seq. + item-103 at level 3: section_header: CRISPR/Cas9 mediated deletion of KRAB-ZFP clusters and an MMETn insertion + item-104 at level 4: inline: group group + item-105 at level 5: text: All gRNAs were expressed from th ... -Chimeric_BB-CBh-hSpCas9 vector (RRID: + item-106 at level 5: text: Addgene_42230 + item-107 at level 5: text: ) and nucleofected into 10 + item-108 at level 5: text: 6 + item-109 at level 5: text: ES cells using Amaxa nucleofecti ... PCR genotyping (Supplementary file 3). + item-110 at level 3: section_header: ChIP-seq analysis + item-111 at level 4: inline: group group + item-112 at level 5: text: For ChIP-seq analysis of KRAB-ZFP expressing cells, 5–10 × 10 + item-113 at level 5: text: 7 + item-114 at level 5: text: cells were crosslinked and immun ... -FLAG (Sigma-Aldrich Cat# F1804, RRID: + item-115 at level 5: text: AB_262044 + item-116 at level 5: text: ) or anti-HA (Abcam Cat# ab9110, RRID: + item-117 at level 5: text: AB_307019 + item-118 at level 5: text: or Covance Cat# MMS-101P-200, RRID: + item-119 at level 5: text: AB_10064068 + item-120 at level 5: text: ) antibody using one of two prev ... serum (Active Motif Cat# 39161, RRID: + item-121 at level 5: text: AB_2532132 + item-122 at level 5: text: ) as described previously (Karim ... Fisher Scientific Cat# A-11122, RRID: + item-123 at level 5: text: AB_221569 + item-124 at level 5: text: ) using a previously described p ... inst H3K4me3 (Abcam Cat# ab8580, RRID: + item-125 at level 5: text: AB_306649 + item-126 at level 5: text: ), H3K4me1 (Abcam Cat# ab8895, RRID: + item-127 at level 5: text: AB_306847 + item-128 at level 5: text: ) and H3K27ac (Abcam Cat# ab4729, RRID: + item-129 at level 5: text: AB_2118291 + item-130 at level 5: text: ) following the protocol develop ... 010 or Khil et al., 2012 respectively. + item-131 at level 4: inline: group group + item-132 at level 5: text: ChIP-seq libraries were construc ... to the mm9 genome using Bowtie (RRID: + item-133 at level 5: text: SCR_005476 + item-134 at level 5: text: ; settings: --best) or Bowtie2 ( ... Peaks were called using MACS14 (RRID: + item-135 at level 5: text: SCR_013291 + item-136 at level 5: text: ) under high stringency settings ... element in UCSC Genome Browser (RRID: + item-137 at level 5: text: SCR_005780 + item-138 at level 5: text: ) were calculated by using the b ... ettings: -f 0.25) from BEDTools (RRID: + item-139 at level 5: text: SCR_006646 + item-140 at level 5: text: ). The right-tailed p-values bet ... were re-mapped using Bowtie (--best). + item-141 at level 3: section_header: Luciferase reporter assays + item-142 at level 4: inline: group group + item-143 at level 5: text: For KRAB-ZFP repression assays, ... y of the MMETn element upstream of the + item-144 at level 5: text: Cd59a + item-145 at level 5: text: gene, fragments of varying sizes ... after transfection as described above. + item-146 at level 3: section_header: RNA-seq analysis + item-147 at level 4: inline: group group + item-148 at level 5: text: Whole RNA was purified using RNe ... reads on an Illumina HiSeq2500 (RRID: + item-149 at level 5: text: SCR_016383 + item-150 at level 5: text: ) or HiSeq3000 (RRID: + item-151 at level 5: text: SCR_016386 + item-152 at level 5: text: ) machine (Supplementary file 4) ... mouse genome (mm9) using Tophat (RRID: + item-153 at level 5: text: SCR_013035 + item-154 at level 5: text: ; settings: --I 200000 g 1) unle ... h TEs annotated in Repeatmasker (RRID: + item-155 at level 5: text: SCR_012954 + item-156 at level 5: text: ) were counted using BEDTools Mu ... expression analysis with DESeq2 (RRID: + item-157 at level 5: text: SCR_015687 + item-158 at level 5: text: ). For differential gene express ... function of BED tools. The probability + item-159 at level 5: text: p + item-160 at level 5: text: in the binomial distribution was ... apped with KRAB-ZFP peaks. Then, given + item-161 at level 5: text: n + item-162 at level 5: text: which is the number of specific groups of genes, and + item-163 at level 5: text: x + item-164 at level 5: text: which is the number of this grou ... lemented in the R function p.adjust(). + item-165 at level 3: section_header: Reduced representation bisulfite sequencing (RRBS-seq) + item-166 at level 4: text: For RRBS-seq analysis, Chr4-cl W ... h sample were considered for analysis. + item-167 at level 3: section_header: Retrotransposition assay + item-168 at level 4: inline: group group + item-169 at level 5: text: The retrotransposition vectors p ... MusD retrotransposition assays, 5 × 10 + item-170 at level 5: text: 4 + item-171 at level 5: text: HeLa cells (ATCC CCL-2) were tra ... were stained with Amido Black (Sigma). + item-172 at level 3: section_header: Capture-seq screen + item-173 at level 4: inline: group group + item-174 at level 5: text: To identify novel retrotransposo ... target enrichment using the SureSelect + item-175 at level 5: text: QXT + item-176 at level 5: text: Target Enrichment kit (Agilent). ... assembly using the Unicycler software. + item-177 at level 2: section_header: Funding Information + item-178 at level 3: text: This paper was supported by the following grants: + item-179 at level 3: list: group list + item-180 at level 4: list_item: http://dx.doi.org/10.13039/10000 ... ment 1ZIAHD008933 to Todd S Macfarlan. + item-181 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... ndation 310030_152879 to Didier Trono. + item-182 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... dation 310030B_173337 to Didier Trono. + item-183 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... ch Council No. 268721 to Didier Trono. + item-184 at level 4: list_item: http://dx.doi.org/10.13039/50110 ... rch Council No 694658 to Didier Trono. + item-185 at level 2: section_header: Acknowledgements + item-186 at level 3: text: We thank Alex Grinberg, Jeanne Y ... 268721; Transpos-X, No. 694658) (DT). + item-187 at level 2: section_header: Additional information + item-188 at level 3: section_header: Competing interests + item-189 at level 4: list: group footnotes + item-190 at level 5: list_item: + item-191 at level 6: footnote: No competing interests declared. + item-192 at level 3: section_header: Author contributions + item-193 at level 4: list: group footnotes + item-194 at level 5: list_item: + item-195 at level 6: footnote: Conceptualization, Data curation ... Methodology, Writing - original draft. + item-196 at level 5: list_item: + item-197 at level 6: footnote: Conceptualization, Data curation ... l draft, Writing - review and editing. + item-198 at level 5: list_item: + item-199 at level 6: footnote: Conceptualization, Data curation ... odology, Writing - review and editing. + item-200 at level 5: list_item: + item-201 at level 6: footnote: Conceptualization, Formal analys ... igation, Writing - review and editing. + item-202 at level 5: list_item: + item-203 at level 6: footnote: Investigation. + item-204 at level 5: list_item: + item-205 at level 6: footnote: Investigation. + item-206 at level 5: list_item: + item-207 at level 6: footnote: Data curation, Software, Formal analysis, Visualization. + item-208 at level 5: list_item: + item-209 at level 6: footnote: Investigation. + item-210 at level 5: list_item: + item-211 at level 6: footnote: Conceptualization, Resources, Su ... igation, Writing - review and editing. + item-212 at level 5: list_item: + item-213 at level 6: footnote: Conceptualization, Resources, Su ... tration, Writing - review and editing. + item-214 at level 3: section_header: Ethics + item-215 at level 4: list: group footnotes + item-216 at level 5: list_item: + item-217 at level 6: footnote: Animal experimentation: All stud ... er IACUC animal protocol (ASP )18-026. + item-218 at level 2: section_header: Additional files + item-219 at level 2: section_header: Data availability + item-220 at level 3: text: All NGS data has been deposited ... GenBank database (MH449667- MH449669). + item-221 at level 3: text: The following datasets were generated: + item-222 at level 3: text: Wolf G. Retrotransposon reactiva ... ession Omnibus (2019). NCBI: GSE115291 + item-223 at level 3: text: Wolf G. Mus musculus musculus st ... e. NCBI GenBank (2019). NCBI: MH449667 + item-224 at level 3: text: Wolf G. Mus musculus musculus st ... e. NCBI GenBank (2019). NCBI: MH449668 + item-225 at level 3: text: Wolf G. Mus musculus musculus st ... e. NCBI GenBank (2019). NCBI: MH449669 + item-226 at level 3: text: The following previously published datasets were used: + item-227 at level 3: text: Castro-Diaz N, Ecco G, Coluccio ... ssion Omnibus (2014). NCBI: GSM1406445 + item-228 at level 3: text: Andrew ZX. H3K9me3_ChIPSeq (Ctrl ... ssion Omnibus (2014). NCBI: GSM1327148 + item-229 at level 2: section_header: References + item-230 at level 3: list: group list + item-231 at level 4: list_item: Bailey TL, Boden M, Buske FA, Fr ... OI: 10.1093/nar/gkp335, PMID: 19458158 + item-232 at level 4: list_item: Baust C, Gagnier L, Baillie GJ, ... 77.21.11448-11458.2003, PMID: 14557630 + item-233 at level 4: list_item: Blaschke K, Ebata KT, Karimi MM, ... I: 10.1038/nature12362, PMID: 23812591 + item-234 at level 4: list_item: Brodziak A, Ziółko E, Muc-Wierzg ... I: 10.12659/msm.882892, PMID: 22648263 + item-235 at level 4: list_item: Castro-Diaz N, Ecco G, Coluccio ... 10.1101/gad.241661.114, PMID: 24939876 + item-236 at level 4: list_item: Chuong EB, Elde NC, Feschotte C. ... 0.1126/science.aad5497, PMID: 26941318 + item-237 at level 4: list_item: Dan J, Liu Y, Liu N, Chiourea M, ... 6/j.devcel.2014.03.004, PMID: 24735877 + item-238 at level 4: list_item: De Iaco A, Planet E, Coluccio A, ... . DOI: 10.1038/ng.3858, PMID: 28459456 + item-239 at level 4: list_item: Deniz Ö, de la Rica L, Cheng KCL ... 1186/s13059-017-1376-y, PMID: 29351814 + item-240 at level 4: list_item: Dewannieux M, Heidmann T. Endoge ... 6/j.coviro.2013.08.005, PMID: 24004725 + item-241 at level 4: list_item: Ecco G, Cassano M, Kauzlaric A, ... 6/j.devcel.2016.02.024, PMID: 27003935 + item-242 at level 4: list_item: Ecco G, Imbeault M, Trono D. KRA ... OI: 10.1242/dev.132605, PMID: 28765213 + item-243 at level 4: list_item: Frank JA, Feschotte C. Co-option ... 6/j.coviro.2017.07.021, PMID: 28818736 + item-244 at level 4: list_item: Gagnier L, Belancio VP, Mager DL ... 1186/s13100-019-0157-4, PMID: 31011371 + item-245 at level 4: list_item: Groner AC, Meylan S, Ciuffi A, Z ... 1/journal.pgen.1000869, PMID: 20221260 + item-246 at level 4: list_item: Hancks DC, Kazazian HH. Roles fo ... 1186/s13100-016-0065-9, PMID: 27158268 + item-247 at level 4: list_item: Imbeault M, Helleboid PY, Trono ... I: 10.1038/nature21683, PMID: 28273063 + item-248 at level 4: list_item: Jacobs FM, Greenberg D, Nguyen N ... I: 10.1038/nature13760, PMID: 25274305 + item-249 at level 4: list_item: Kano H, Kurahashi H, Toda T. Gen ... 0.1073/pnas.0705483104, PMID: 17984064 + item-250 at level 4: list_item: Karimi MM, Goyal P, Maksakova IA ... 016/j.stem.2011.04.004, PMID: 21624812 + item-251 at level 4: list_item: Kauzlaric A, Ecco G, Cassano M, ... 1/journal.pone.0173746, PMID: 28334004 + item-252 at level 4: list_item: Khil PP, Smagulova F, Brick KM, ... 10.1101/gr.130583.111, PMID: 22367190 + item-253 at level 4: list_item: Krueger F, Andrews SR. Bismark: ... /bioinformatics/btr167, PMID: 21493656 + item-254 at level 4: list_item: Langmead B, Salzberg SL. Fast ga ... OI: 10.1038/nmeth.1923, PMID: 22388286 + item-255 at level 4: list_item: Legiewicz M, Zolotukhin AS, Pilk ... 0.1074/jbc.M110.182840, PMID: 20978285 + item-256 at level 4: list_item: Lehoczky JA, Thomas PE, Patrie K ... 1/journal.pgen.1003967, PMID: 24339789 + item-257 at level 4: list_item: Leung D, Du T, Wagner U, Xie W, ... 0.1073/pnas.1322273111, PMID: 24757056 + item-258 at level 4: list_item: Lilue J, Doran AG, Fiddes IT, Ab ... 1038/s41588-018-0223-8, PMID: 30275530 + item-259 at level 4: list_item: Liu S, Brind'Amour J, Karimi MM, ... 10.1101/gad.244848.114, PMID: 25228647 + item-260 at level 4: list_item: Love MI, Huber W, Anders S. Mode ... 1186/s13059-014-0550-8, PMID: 25516281 + item-261 at level 4: list_item: Lugani F, Arora R, Papeta N, Pat ... 1/journal.pgen.1003206, PMID: 23437001 + item-262 at level 4: list_item: Macfarlan TS, Gifford WD, Drisco ... I: 10.1038/nature11244, PMID: 22722858 + item-263 at level 4: list_item: Maksakova IA, Romanish MT, Gagni ... 1/journal.pgen.0020002, PMID: 16440055 + item-264 at level 4: list_item: Matsui T, Leung D, Miyashita H, ... I: 10.1038/nature08858, PMID: 20164836 + item-265 at level 4: list_item: Najafabadi HS, Mnaimneh S, Schmi ... DOI: 10.1038/nbt.3128, PMID: 25690854 + item-266 at level 4: list_item: Nellåker C, Keane TM, Yalcin B, ... .1186/gb-2012-13-6-r45, PMID: 22703977 + item-267 at level 4: list_item: O'Geen H, Frietze S, Farnham PJ. ... 7/978-1-60761-753-2_27, PMID: 20680851 + item-268 at level 4: list_item: Patel A, Yang P, Tinkham M, Prad ... 016/j.cell.2018.02.058, PMID: 29551271 + item-269 at level 4: list_item: Ribet D, Dewannieux M, Heidmann ... OI: 10.1101/gr.2924904, PMID: 15479948 + item-270 at level 4: list_item: Richardson SR, Gerdes P, Gerhard ... 10.1101/gr.219022.116, PMID: 28483779 + item-271 at level 4: list_item: Rowe HM, Jakobsson J, Mesnard D, ... I: 10.1038/nature08674, PMID: 20075919 + item-272 at level 4: list_item: Rowe HM, Kapopoulou A, Corsinott ... 10.1101/gr.147678.112, PMID: 23233547 + item-273 at level 4: list_item: Schauer SN, Carreira PE, Shukla ... 10.1101/gr.226993.117, PMID: 29643204 + item-274 at level 4: list_item: Schultz DC, Ayyanathan K, Negore ... OI: 10.1101/gad.973302, PMID: 11959841 + item-275 at level 4: list_item: Semba K, Araki K, Matsumoto K, S ... 1/journal.pgen.1003204, PMID: 23436999 + item-276 at level 4: list_item: Sripathy SP, Stevens J, Schultz ... : 10.1128/MCB.00487-06, PMID: 16954381 + item-277 at level 4: list_item: Thomas JH, Schneider S. Coevolut ... 10.1101/gr.121749.111, PMID: 21784874 + item-278 at level 4: list_item: Thompson PJ, Macfarlan TS, Lorin ... 6/j.molcel.2016.03.029, PMID: 27259207 + item-279 at level 4: list_item: Treger RS, Pope SD, Kong Y, Toku ... 6/j.immuni.2018.12.022, PMID: 30709743 + item-280 at level 4: list_item: Vlangos CN, Siuniak AN, Robinson ... 1/journal.pgen.1003205, PMID: 23437000 + item-281 at level 4: list_item: Wang J, Xie G, Singh M, Ghanbari ... I: 10.1038/nature13804, PMID: 25317556 + item-282 at level 4: list_item: Wolf D, Hug K, Goff SP. TRIM28 m ... 0.1073/pnas.0805540105, PMID: 18713861 + item-283 at level 4: list_item: Wolf G, Greenberg D, Macfarlan T ... 1186/s13100-015-0050-8, PMID: 26435754 + item-284 at level 4: list_item: Wolf G, Yang P, Füchtbauer AC, F ... 10.1101/gad.252767.114, PMID: 25737282 + item-285 at level 4: list_item: Yamauchi M, Freitag B, Khan C, B ... JVI.69.2.1142-1149.1995, PMID: 7529329 + item-286 at level 4: list_item: Zhang Y, Liu T, Meyer CA, Eeckho ... .1186/gb-2008-9-9-r137, PMID: 18798982 + item-287 at level 1: caption: Figure 1. Genome-wide binding pa ... onsensus fingers highlighted in white. + item-288 at level 1: caption: Table 1. KRAB-ZFP genes clusters ... ChIP-seq was performed in this study. + item-289 at level 1: caption: Figure 2. Retrotransposon reacti ... s were calculated using paired t-test. + item-290 at level 1: caption: Figure 3. TE-dependent gene acti ... Gm13051 are indicated by dashed lines. + item-291 at level 1: caption: Figure 4. ETn retrotransposition ... combined for the statistical analysis. + item-292 at level 1: caption: Key resources table \ No newline at end of file diff --git a/tests/data/jats/groundtruth/elife-56337.nxml.json b/tests/data/jats/groundtruth/elife-56337.nxml.json index cd7949980c..72b067a536 100644 --- a/tests/data/jats/groundtruth/elife-56337.nxml.json +++ b/tests/data/jats/groundtruth/elife-56337.nxml.json @@ -151,17 +151,65 @@ { "self_ref": "#/groups/4", "parent": { - "$ref": "#/texts/53" + "$ref": "#/tables/1" }, "children": [ + { + "$ref": "#/groups/5" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_4_7", + "label": "unspecified" + }, + { + "self_ref": "#/groups/5", + "parent": { + "$ref": "#/groups/4" + }, + "children": [ + { + "$ref": "#/texts/53" + }, { "$ref": "#/texts/54" }, { "$ref": "#/texts/55" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/6", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/7" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_4_8", + "label": "unspecified" + }, + { + "self_ref": "#/groups/7", + "parent": { + "$ref": "#/groups/6" + }, + "children": [ { "$ref": "#/texts/56" + }, + { + "$ref": "#/texts/57" + }, + { + "$ref": "#/texts/58" } ], "content_layer": "body", @@ -169,19 +217,33 @@ "label": "inline" }, { - "self_ref": "#/groups/5", + "self_ref": "#/groups/8", "parent": { - "$ref": "#/texts/57" + "$ref": "#/tables/1" }, "children": [ { - "$ref": "#/texts/58" - }, + "$ref": "#/groups/9" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_4_10", + "label": "unspecified" + }, + { + "self_ref": "#/groups/9", + "parent": { + "$ref": "#/groups/8" + }, + "children": [ { "$ref": "#/texts/59" }, { "$ref": "#/texts/60" + }, + { + "$ref": "#/texts/61" } ], "content_layer": "body", @@ -189,9 +251,23 @@ "label": "inline" }, { - "self_ref": "#/groups/6", + "self_ref": "#/groups/10", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/11" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_4_11", + "label": "unspecified" + }, + { + "self_ref": "#/groups/11", "parent": { - "$ref": "#/texts/61" + "$ref": "#/groups/10" }, "children": [ { @@ -202,12 +278,40 @@ }, { "$ref": "#/texts/64" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/12", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/13" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_4_12", + "label": "unspecified" + }, + { + "self_ref": "#/groups/13", + "parent": { + "$ref": "#/groups/12" + }, + "children": [ { "$ref": "#/texts/65" }, { "$ref": "#/texts/66" + }, + { + "$ref": "#/texts/67" } ], "content_layer": "body", @@ -215,9 +319,23 @@ "label": "inline" }, { - "self_ref": "#/groups/7", + "self_ref": "#/groups/14", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/15" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_4_13", + "label": "unspecified" + }, + { + "self_ref": "#/groups/15", "parent": { - "$ref": "#/texts/67" + "$ref": "#/groups/14" }, "children": [ { @@ -228,7 +346,32 @@ }, { "$ref": "#/texts/70" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/16", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/17" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_4_14", + "label": "unspecified" + }, + { + "self_ref": "#/groups/17", + "parent": { + "$ref": "#/groups/16" + }, + "children": [ { "$ref": "#/texts/71" }, @@ -237,10 +380,18 @@ }, { "$ref": "#/texts/73" - }, - { - "$ref": "#/texts/74" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/18", + "parent": { + "$ref": "#/texts/74" + }, + "children": [ { "$ref": "#/texts/75" }, @@ -249,10 +400,18 @@ }, { "$ref": "#/texts/77" - }, - { - "$ref": "#/texts/78" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/19", + "parent": { + "$ref": "#/texts/78" + }, + "children": [ { "$ref": "#/texts/79" }, @@ -261,10 +420,18 @@ }, { "$ref": "#/texts/81" - }, - { - "$ref": "#/texts/82" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/20", + "parent": { + "$ref": "#/texts/82" + }, + "children": [ { "$ref": "#/texts/83" }, @@ -276,6 +443,9 @@ }, { "$ref": "#/texts/86" + }, + { + "$ref": "#/texts/87" } ], "content_layer": "body", @@ -283,17 +453,11 @@ "label": "inline" }, { - "self_ref": "#/groups/8", + "self_ref": "#/groups/21", "parent": { - "$ref": "#/texts/67" + "$ref": "#/texts/88" }, "children": [ - { - "$ref": "#/texts/87" - }, - { - "$ref": "#/texts/88" - }, { "$ref": "#/texts/89" }, @@ -314,18 +478,10 @@ }, { "$ref": "#/texts/95" - } - ], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/9", - "parent": { - "$ref": "#/texts/96" - }, - "children": [ + }, + { + "$ref": "#/texts/96" + }, { "$ref": "#/texts/97" }, @@ -334,18 +490,10 @@ }, { "$ref": "#/texts/99" - } - ], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/10", - "parent": { - "$ref": "#/texts/100" - }, - "children": [ + }, + { + "$ref": "#/texts/100" + }, { "$ref": "#/texts/101" }, @@ -366,7 +514,18 @@ }, { "$ref": "#/texts/107" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/22", + "parent": { + "$ref": "#/texts/88" + }, + "children": [ { "$ref": "#/texts/108" }, @@ -393,9 +552,6 @@ }, { "$ref": "#/texts/116" - }, - { - "$ref": "#/texts/117" } ], "content_layer": "body", @@ -403,19 +559,19 @@ "label": "inline" }, { - "self_ref": "#/groups/11", + "self_ref": "#/groups/23", "parent": { - "$ref": "#/texts/120" + "$ref": "#/texts/117" }, "children": [ { - "$ref": "#/texts/121" + "$ref": "#/texts/118" }, { - "$ref": "#/texts/122" + "$ref": "#/texts/119" }, { - "$ref": "#/texts/123" + "$ref": "#/texts/120" } ], "content_layer": "body", @@ -423,11 +579,20 @@ "label": "inline" }, { - "self_ref": "#/groups/12", + "self_ref": "#/groups/24", "parent": { - "$ref": "#/texts/124" + "$ref": "#/texts/121" }, "children": [ + { + "$ref": "#/texts/122" + }, + { + "$ref": "#/texts/123" + }, + { + "$ref": "#/texts/124" + }, { "$ref": "#/texts/125" }, @@ -436,18 +601,13 @@ }, { "$ref": "#/texts/127" - } - ], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/13", - "parent": { - "$ref": "#/texts/128" - }, - "children": [ + }, + { + "$ref": "#/texts/128" + }, + { + "$ref": "#/texts/129" + }, { "$ref": "#/texts/130" }, @@ -462,75 +622,98 @@ }, { "$ref": "#/texts/134" + }, + { + "$ref": "#/texts/135" + }, + { + "$ref": "#/texts/136" + }, + { + "$ref": "#/texts/137" + }, + { + "$ref": "#/texts/138" } ], "content_layer": "body", - "name": "list", - "label": "list" + "name": "group", + "label": "inline" }, { - "self_ref": "#/groups/14", + "self_ref": "#/groups/25", "parent": { - "$ref": "#/texts/138" + "$ref": "#/texts/141" }, "children": [ { - "$ref": "#/texts/139" + "$ref": "#/texts/142" + }, + { + "$ref": "#/texts/143" + }, + { + "$ref": "#/texts/144" } ], "content_layer": "body", - "name": "footnotes", - "label": "list" + "name": "group", + "label": "inline" }, { - "self_ref": "#/groups/15", + "self_ref": "#/groups/26", "parent": { - "$ref": "#/texts/141" + "$ref": "#/texts/145" }, "children": [ { - "$ref": "#/texts/142" - }, - { - "$ref": "#/texts/144" + "$ref": "#/texts/146" }, { - "$ref": "#/texts/146" + "$ref": "#/texts/147" }, { "$ref": "#/texts/148" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/27", + "parent": { + "$ref": "#/texts/149" + }, + "children": [ { - "$ref": "#/texts/150" + "$ref": "#/texts/151" }, { "$ref": "#/texts/152" }, { - "$ref": "#/texts/154" - }, - { - "$ref": "#/texts/156" + "$ref": "#/texts/153" }, { - "$ref": "#/texts/158" + "$ref": "#/texts/154" }, { - "$ref": "#/texts/160" + "$ref": "#/texts/155" } ], "content_layer": "body", - "name": "footnotes", + "name": "list", "label": "list" }, { - "self_ref": "#/groups/16", + "self_ref": "#/groups/28", "parent": { - "$ref": "#/texts/162" + "$ref": "#/texts/159" }, "children": [ { - "$ref": "#/texts/163" + "$ref": "#/texts/160" } ], "content_layer": "body", @@ -538,74 +721,66 @@ "label": "list" }, { - "self_ref": "#/groups/17", + "self_ref": "#/groups/29", "parent": { - "$ref": "#/texts/176" + "$ref": "#/texts/162" }, "children": [ { - "$ref": "#/texts/177" - }, - { - "$ref": "#/texts/178" - }, - { - "$ref": "#/texts/179" - }, - { - "$ref": "#/texts/180" - }, - { - "$ref": "#/texts/181" - }, - { - "$ref": "#/texts/182" - }, - { - "$ref": "#/texts/183" - }, - { - "$ref": "#/texts/184" - }, - { - "$ref": "#/texts/185" - }, - { - "$ref": "#/texts/186" - }, - { - "$ref": "#/texts/187" + "$ref": "#/texts/163" }, { - "$ref": "#/texts/188" + "$ref": "#/texts/165" }, { - "$ref": "#/texts/189" + "$ref": "#/texts/167" }, { - "$ref": "#/texts/190" + "$ref": "#/texts/169" }, { - "$ref": "#/texts/191" + "$ref": "#/texts/171" }, { - "$ref": "#/texts/192" + "$ref": "#/texts/173" }, { - "$ref": "#/texts/193" + "$ref": "#/texts/175" }, { - "$ref": "#/texts/194" + "$ref": "#/texts/177" }, { - "$ref": "#/texts/195" + "$ref": "#/texts/179" }, { - "$ref": "#/texts/196" - }, + "$ref": "#/texts/181" + } + ], + "content_layer": "body", + "name": "footnotes", + "label": "list" + }, + { + "self_ref": "#/groups/30", + "parent": { + "$ref": "#/texts/183" + }, + "children": [ { - "$ref": "#/texts/197" - }, + "$ref": "#/texts/184" + } + ], + "content_layer": "body", + "name": "footnotes", + "label": "list" + }, + { + "self_ref": "#/groups/31", + "parent": { + "$ref": "#/texts/197" + }, + "children": [ { "$ref": "#/texts/198" }, @@ -710,6 +885,69 @@ }, { "$ref": "#/texts/232" + }, + { + "$ref": "#/texts/233" + }, + { + "$ref": "#/texts/234" + }, + { + "$ref": "#/texts/235" + }, + { + "$ref": "#/texts/236" + }, + { + "$ref": "#/texts/237" + }, + { + "$ref": "#/texts/238" + }, + { + "$ref": "#/texts/239" + }, + { + "$ref": "#/texts/240" + }, + { + "$ref": "#/texts/241" + }, + { + "$ref": "#/texts/242" + }, + { + "$ref": "#/texts/243" + }, + { + "$ref": "#/texts/244" + }, + { + "$ref": "#/texts/245" + }, + { + "$ref": "#/texts/246" + }, + { + "$ref": "#/texts/247" + }, + { + "$ref": "#/texts/248" + }, + { + "$ref": "#/texts/249" + }, + { + "$ref": "#/texts/250" + }, + { + "$ref": "#/texts/251" + }, + { + "$ref": "#/texts/252" + }, + { + "$ref": "#/texts/253" } ], "content_layer": "body", @@ -746,22 +984,22 @@ "$ref": "#/texts/51" }, { - "$ref": "#/texts/128" + "$ref": "#/texts/149" }, { - "$ref": "#/texts/135" + "$ref": "#/texts/156" }, { - "$ref": "#/texts/137" + "$ref": "#/texts/158" }, { - "$ref": "#/texts/165" + "$ref": "#/texts/186" }, { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, { - "$ref": "#/texts/176" + "$ref": "#/texts/197" } ], "content_layer": "body", @@ -1392,204 +1630,505 @@ } ], "content_layer": "body", - "label": "section_header", + "label": "section_header", + "prov": [], + "orig": "ETn retrotransposition in Chr4-cl KO and WT mice", + "text": "ETn retrotransposition in Chr4-cl KO and WT mice", + "level": 2 + }, + { + "self_ref": "#/texts/41", + "parent": { + "$ref": "#/texts/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "IAP, ETn/ETnERV and MuLV/RLTR4 retrotransposons are highly polymorphic in inbred mouse strains (Nellåker et al., 2012), indicating that these elements are able to mobilize in the germ line. Since these retrotransposons are upregulated in Chr2-cl and Chr4-cl KO ES cells, we speculated that these KRAB-ZFP clusters evolved to minimize the risks of insertional mutagenesis by retrotransposition. To test this, we generated Chr2-cl and Chr4-cl KO mice via ES cell injection into blastocysts, and after germ line transmission we genotyped the offspring of heterozygous breeding pairs. While the offspring of Chr4-cl KO/WT parents were born close to Mendelian ratios in pure C57BL/6 and mixed C57BL/6 129Sv matings, one Chr4-cl KO/WT breeding pair gave birth to significantly fewer KO mice than expected (p-value=0.022) (Figure 4—figure supplement 1A). Likewise, two out of four Chr2-cl KO breeding pairs on mixed C57BL/6 129Sv matings failed to give birth to a single KO offspring (p-value<0.01) while the two other mating pairs produced KO offspring at near Mendelian ratios (Figure 4—figure supplement 1A). Altogether, these data indicate that KRAB-ZFP clusters are not absolutely essential in mice, but that genetic and/or epigenetic factors may contribute to reduced viability.", + "text": "IAP, ETn/ETnERV and MuLV/RLTR4 retrotransposons are highly polymorphic in inbred mouse strains (Nellåker et al., 2012), indicating that these elements are able to mobilize in the germ line. Since these retrotransposons are upregulated in Chr2-cl and Chr4-cl KO ES cells, we speculated that these KRAB-ZFP clusters evolved to minimize the risks of insertional mutagenesis by retrotransposition. To test this, we generated Chr2-cl and Chr4-cl KO mice via ES cell injection into blastocysts, and after germ line transmission we genotyped the offspring of heterozygous breeding pairs. While the offspring of Chr4-cl KO/WT parents were born close to Mendelian ratios in pure C57BL/6 and mixed C57BL/6 129Sv matings, one Chr4-cl KO/WT breeding pair gave birth to significantly fewer KO mice than expected (p-value=0.022) (Figure 4—figure supplement 1A). Likewise, two out of four Chr2-cl KO breeding pairs on mixed C57BL/6 129Sv matings failed to give birth to a single KO offspring (p-value<0.01) while the two other mating pairs produced KO offspring at near Mendelian ratios (Figure 4—figure supplement 1A). Altogether, these data indicate that KRAB-ZFP clusters are not absolutely essential in mice, but that genetic and/or epigenetic factors may contribute to reduced viability." + }, + { + "self_ref": "#/texts/42", + "parent": { + "$ref": "#/texts/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "We reasoned that retrotransposon activation could account for the reduced viability of Chr2-cl and Chr4-cl KO mice in some matings. However, since only rare matings produced non-viable KO embryos, we instead turned to the viable KO mice to assay for increased transposon activity. RNA-seq in blood, brain and testis revealed that, with a few exceptions, retrotransposons upregulated in Chr2 and Chr4 KRAB-ZFP cluster KO ES cells are not expressed at higher levels in adult tissues (Figure 4—figure supplement 1B). Likewise, no strong transcriptional TE reactivation phenotype was observed in liver and kidney of Chr4-cl KO mice (data not shown) and ChIP-seq with antibodies against H3K4me1, H3K4me3 and H3K27ac in testis of Chr4-cl WT and KO mice revealed no increase of active histone marks at ETn elements or other TEs (data not shown). This indicates that Chr2-cl and Chr4-cl KRAB-ZFPs are primarily required for TE repression during early development. This is consistent with the high expression of these KRAB-ZFPs uniquely in ES cells (Figure 1—figure supplement 1A). To determine whether retrotransposition occurs at a higher frequency in Chr4-cl KO mice during development, we screened for novel ETn (ETn/ETnERV) and MuLV (MuLV/RLTR4_MM) insertions in viable Chr4-cl KO mice. For this purpose, we developed a capture-sequencing approach to enrich for ETn/MuLV DNA and flanking sequences from genomic DNA using probes that hybridize with the 5’ and 3’ ends of ETn and MuLV LTRs prior to deep sequencing. We screened genomic DNA samples from a total of 76 mice, including 54 mice from ancestry-controlled Chr4-cl KO matings in various strain backgrounds, the two ES cell lines the Chr4-cl KO mice were generated from, and eight mice from a Chr2-cl KO mating which served as a control (since ETn and MuLVs are not activated in Chr2-cl KO ES cells) (Supplementary file 4). Using this approach, we were able to enrich reads mapping to ETn/MuLV LTRs about 2,000-fold compared to genome sequencing without capture. ETn/MuLV insertions were determined by counting uniquely mapped reads that were paired with reads mapping to ETn/MuLV elements (see materials and methods for details). To assess the efficiency of the capture approach, we determined what proportion of a set of 309 largely intact (two LTRs flanking an internal sequence) reference ETn elements could be identified using our sequencing data. 95% of these insertions were called with high confidence in the majority of our samples (data not shown), indicating that we are able to identify ETn insertions at a high recovery rate.", + "text": "We reasoned that retrotransposon activation could account for the reduced viability of Chr2-cl and Chr4-cl KO mice in some matings. However, since only rare matings produced non-viable KO embryos, we instead turned to the viable KO mice to assay for increased transposon activity. RNA-seq in blood, brain and testis revealed that, with a few exceptions, retrotransposons upregulated in Chr2 and Chr4 KRAB-ZFP cluster KO ES cells are not expressed at higher levels in adult tissues (Figure 4—figure supplement 1B). Likewise, no strong transcriptional TE reactivation phenotype was observed in liver and kidney of Chr4-cl KO mice (data not shown) and ChIP-seq with antibodies against H3K4me1, H3K4me3 and H3K27ac in testis of Chr4-cl WT and KO mice revealed no increase of active histone marks at ETn elements or other TEs (data not shown). This indicates that Chr2-cl and Chr4-cl KRAB-ZFPs are primarily required for TE repression during early development. This is consistent with the high expression of these KRAB-ZFPs uniquely in ES cells (Figure 1—figure supplement 1A). To determine whether retrotransposition occurs at a higher frequency in Chr4-cl KO mice during development, we screened for novel ETn (ETn/ETnERV) and MuLV (MuLV/RLTR4_MM) insertions in viable Chr4-cl KO mice. For this purpose, we developed a capture-sequencing approach to enrich for ETn/MuLV DNA and flanking sequences from genomic DNA using probes that hybridize with the 5’ and 3’ ends of ETn and MuLV LTRs prior to deep sequencing. We screened genomic DNA samples from a total of 76 mice, including 54 mice from ancestry-controlled Chr4-cl KO matings in various strain backgrounds, the two ES cell lines the Chr4-cl KO mice were generated from, and eight mice from a Chr2-cl KO mating which served as a control (since ETn and MuLVs are not activated in Chr2-cl KO ES cells) (Supplementary file 4). Using this approach, we were able to enrich reads mapping to ETn/MuLV LTRs about 2,000-fold compared to genome sequencing without capture. ETn/MuLV insertions were determined by counting uniquely mapped reads that were paired with reads mapping to ETn/MuLV elements (see materials and methods for details). To assess the efficiency of the capture approach, we determined what proportion of a set of 309 largely intact (two LTRs flanking an internal sequence) reference ETn elements could be identified using our sequencing data. 95% of these insertions were called with high confidence in the majority of our samples (data not shown), indicating that we are able to identify ETn insertions at a high recovery rate." + }, + { + "self_ref": "#/texts/43", + "parent": { + "$ref": "#/texts/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Using this dataset, we first confirmed the polymorphic nature of both ETn and MuLV retrotransposons in laboratory mouse strains (Figure 4—figure supplement 2A), highlighting the potential of these elements to retrotranspose. To identify novel insertions, we filtered out insertions that were supported by ETn/MuLV-paired reads in more than one animal. While none of the 54 ancestry-controlled mice showed a single novel MuLV insertion, we observed greatly varying numbers of up to 80 novel ETn insertions in our pedigree (Figure 4A).", + "text": "Using this dataset, we first confirmed the polymorphic nature of both ETn and MuLV retrotransposons in laboratory mouse strains (Figure 4—figure supplement 2A), highlighting the potential of these elements to retrotranspose. To identify novel insertions, we filtered out insertions that were supported by ETn/MuLV-paired reads in more than one animal. While none of the 54 ancestry-controlled mice showed a single novel MuLV insertion, we observed greatly varying numbers of up to 80 novel ETn insertions in our pedigree (Figure 4A)." + }, + { + "self_ref": "#/texts/44", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "caption", + "prov": [], + "orig": "Figure 4. ETn retrotransposition in Chr4-cl KO mice. (A) Pedigree of mice used for transposon insertion screening by capture-seq in mice of different strain backgrounds. The number of novel ETn insertions (only present in one animal) are indicated. For animals whose direct ancestors have not been screened, the ETn insertions are shown in parentheses since parental inheritance cannot be excluded in that case. Germ line insertions are indicated by asterisks. All DNA samples were prepared from tail tissues unless noted (-S: spleen, -E: ear, -B:Blood) (B) Statistical analysis of ETn insertion frequency in tail tissue from 30 Chr4-cl KO, KO/WT and WT mice that were derived from one Chr4-c KO x KO/WT and two Chr4-cl KO/WT x KO/WT matings. Only DNA samples that were collected from juvenile tails were considered for this analysis. P-values were calculated using one-sided Wilcoxon Rank Sum Test. In the last panel, KO, WT and KO/WT mice derived from all matings were combined for the statistical analysis.", + "text": "Figure 4. ETn retrotransposition in Chr4-cl KO mice. (A) Pedigree of mice used for transposon insertion screening by capture-seq in mice of different strain backgrounds. The number of novel ETn insertions (only present in one animal) are indicated. For animals whose direct ancestors have not been screened, the ETn insertions are shown in parentheses since parental inheritance cannot be excluded in that case. Germ line insertions are indicated by asterisks. All DNA samples were prepared from tail tissues unless noted (-S: spleen, -E: ear, -B:Blood) (B) Statistical analysis of ETn insertion frequency in tail tissue from 30 Chr4-cl KO, KO/WT and WT mice that were derived from one Chr4-c KO x KO/WT and two Chr4-cl KO/WT x KO/WT matings. Only DNA samples that were collected from juvenile tails were considered for this analysis. P-values were calculated using one-sided Wilcoxon Rank Sum Test. In the last panel, KO, WT and KO/WT mice derived from all matings were combined for the statistical analysis." + }, + { + "self_ref": "#/texts/45", + "parent": { + "$ref": "#/texts/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "To validate some of the novel ETn insertions, we designed specific PCR primers for five of the insertions and screened genomic DNA of the mice in which they were identified as well as their parents. For all tested insertions, we were able to amplify their flanking sequence and show that these insertions are absent in their parents (Figure 4—figure supplement 3A). To confirm their identity, we amplified and sequenced three of the novel full-length ETn insertions. Two of these elements (Genbank accession: MH449667-68) resembled typical ETnII elements with identical 5’ and 3’ LTRs and target site duplications (TSD) of 4 or 6 bp, respectively. The third sequenced element (MH449669) represented a hybrid element that contains both ETnI and MusD (ETnERV) sequences. Similar insertions can be found in the B6 reference genome; however, the identified novel insertion has a 2.5 kb deletion of the 5’ end of the internal region. Additionally, the 5’ and 3’ LTR of this element differ in one nucleotide near the start site and contain an unusually large 248 bp TSD (containing a SINE repeat) indicating that an improper integration process might have truncated this element.", + "text": "To validate some of the novel ETn insertions, we designed specific PCR primers for five of the insertions and screened genomic DNA of the mice in which they were identified as well as their parents. For all tested insertions, we were able to amplify their flanking sequence and show that these insertions are absent in their parents (Figure 4—figure supplement 3A). To confirm their identity, we amplified and sequenced three of the novel full-length ETn insertions. Two of these elements (Genbank accession: MH449667-68) resembled typical ETnII elements with identical 5’ and 3’ LTRs and target site duplications (TSD) of 4 or 6 bp, respectively. The third sequenced element (MH449669) represented a hybrid element that contains both ETnI and MusD (ETnERV) sequences. Similar insertions can be found in the B6 reference genome; however, the identified novel insertion has a 2.5 kb deletion of the 5’ end of the internal region. Additionally, the 5’ and 3’ LTR of this element differ in one nucleotide near the start site and contain an unusually large 248 bp TSD (containing a SINE repeat) indicating that an improper integration process might have truncated this element." + }, + { + "self_ref": "#/texts/46", + "parent": { + "$ref": "#/texts/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Besides novel ETn insertions that were only identified in one specific animal, we also observed three ETn insertions that could be detected in several siblings but not in their parents or any of the other screened mice. This strongly indicates that these retrotransposition events occurred in the germ line of the parents from which they were passed on to some of their offspring. One of these germ line insertions was evidently passed on from the offspring to the next generation (Figure 4A). As expected, the read numbers supporting these novel germ line insertions were comparable to the read numbers that were found in the flanking regions of annotated B6 ETn insertions (Figure 4—figure supplement 3B). In contrast, virtually all novel insertions that were only found in one animal were supported by significantly fewer reads (Figure 4—figure supplement 3B). This indicates that these elements resulted from retrotransposition events in the developing embryo and not in the zygote or parental germ cells. Indeed, we detected different sets of insertions in various tissues from the same animal (Figure 4—figure supplement 3C). Even between tail samples that were collected from the same animal at different ages, only a fraction of the new insertions were present in both samples, while technical replicates from the same genomic DNA samples showed a nearly complete overlap in insertions (Figure 4—figure supplement 3D).", + "text": "Besides novel ETn insertions that were only identified in one specific animal, we also observed three ETn insertions that could be detected in several siblings but not in their parents or any of the other screened mice. This strongly indicates that these retrotransposition events occurred in the germ line of the parents from which they were passed on to some of their offspring. One of these germ line insertions was evidently passed on from the offspring to the next generation (Figure 4A). As expected, the read numbers supporting these novel germ line insertions were comparable to the read numbers that were found in the flanking regions of annotated B6 ETn insertions (Figure 4—figure supplement 3B). In contrast, virtually all novel insertions that were only found in one animal were supported by significantly fewer reads (Figure 4—figure supplement 3B). This indicates that these elements resulted from retrotransposition events in the developing embryo and not in the zygote or parental germ cells. Indeed, we detected different sets of insertions in various tissues from the same animal (Figure 4—figure supplement 3C). Even between tail samples that were collected from the same animal at different ages, only a fraction of the new insertions were present in both samples, while technical replicates from the same genomic DNA samples showed a nearly complete overlap in insertions (Figure 4—figure supplement 3D)." + }, + { + "self_ref": "#/texts/47", + "parent": { + "$ref": "#/texts/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Finally, we asked whether there were more novel ETn insertions in mice lacking the Chr4-cl relative to their wild type and heterozygous littermates in our pedigree. Interestingly, only one out of the eight Chr4-cl KO mice in a pure C57BL/6 strain background and none of the eight offspring from a Chr2-cl mating carried a single novel ETn insertion (Figure 4A). When crossing into a 129Sv background for a single generation before intercrossing heterozygous mice (F1), we observed 4 out of 8 Chr4-cl KO mice that contained at least one new ETn insertion, whereas none of 3 heterozygous mice contained any insertions. After crossing to the 129Sv background for a second generation (F2), we determined the number of novel ETn insertions in the offspring of one KO/WT x KO and two KO/WT x KO/WT matings, excluding all samples that were not derived from juvenile tail tissue. Only in the offspring of the KO/WT x KO mating, we observed a statistically significant higher average number of ETn insertions in KO vs. KO/WT animals (7.3 vs. 29.6, p=0.045, Figure 4B). Other than that, only a non-significant trend towards greater average numbers of ETn insertions in KO (11 vs. 27.8, p=0.192, Figure 4B) was apparent in one of the WT/KO x KO/WT matings whereas no difference in ETn insertion numbers between WT and KO mice could be observed in the second mating WT/KO x KO/WT (26 vs. 31, p=0.668, Figure 4B). When comparing all KO with all WT and WT/KO mice from these three matings, a trend towards more ETn insertions in KO remained but was not supported by strong significance (26 vs. 13, p=0.057, Figure 4B). Altogether, we observed a high variability in the number of new ETn insertions in both KO and WT but our data suggest that the Chr4-cl KRAB-ZFPs may have a modest effect on ETn retrotransposition rates in some mouse strains but other genetic and epigenetic effects clearly also play an important role.", + "text": "Finally, we asked whether there were more novel ETn insertions in mice lacking the Chr4-cl relative to their wild type and heterozygous littermates in our pedigree. Interestingly, only one out of the eight Chr4-cl KO mice in a pure C57BL/6 strain background and none of the eight offspring from a Chr2-cl mating carried a single novel ETn insertion (Figure 4A). When crossing into a 129Sv background for a single generation before intercrossing heterozygous mice (F1), we observed 4 out of 8 Chr4-cl KO mice that contained at least one new ETn insertion, whereas none of 3 heterozygous mice contained any insertions. After crossing to the 129Sv background for a second generation (F2), we determined the number of novel ETn insertions in the offspring of one KO/WT x KO and two KO/WT x KO/WT matings, excluding all samples that were not derived from juvenile tail tissue. Only in the offspring of the KO/WT x KO mating, we observed a statistically significant higher average number of ETn insertions in KO vs. KO/WT animals (7.3 vs. 29.6, p=0.045, Figure 4B). Other than that, only a non-significant trend towards greater average numbers of ETn insertions in KO (11 vs. 27.8, p=0.192, Figure 4B) was apparent in one of the WT/KO x KO/WT matings whereas no difference in ETn insertion numbers between WT and KO mice could be observed in the second mating WT/KO x KO/WT (26 vs. 31, p=0.668, Figure 4B). When comparing all KO with all WT and WT/KO mice from these three matings, a trend towards more ETn insertions in KO remained but was not supported by strong significance (26 vs. 13, p=0.057, Figure 4B). Altogether, we observed a high variability in the number of new ETn insertions in both KO and WT but our data suggest that the Chr4-cl KRAB-ZFPs may have a modest effect on ETn retrotransposition rates in some mouse strains but other genetic and epigenetic effects clearly also play an important role." + }, + { + "self_ref": "#/texts/48", + "parent": { + "$ref": "#/texts/0" + }, + "children": [ + { + "$ref": "#/texts/49" + }, + { + "$ref": "#/texts/50" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Discussion", + "text": "Discussion", + "level": 1 + }, + { + "self_ref": "#/texts/49", + "parent": { + "$ref": "#/texts/48" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "C2H2 zinc finger proteins, about half of which contain a KRAB repressor domain, represent the largest DNA-binding protein family in mammals. Nevertheless, most of these factors have not been investigated using loss-of-function studies. The most comprehensive characterization of human KRAB-ZFPs revealed a strong preference to bind TEs (Imbeault et al., 2017; Najafabadi et al., 2015) yet their function remains unknown. In humans, very few TEs are capable of retrotransposition yet many of them, often tens of million years old, are bound by KRAB-ZFPs. While this suggests that human KRAB-ZFPs mainly serve to control TE-borne enhancers and may have potentially transcription-independent functions, we were interested in the biological significance of KRAB-ZFPs in restricting potentially active TEs. The mouse is an ideal model for such studies since the mouse genome contains several active TE families, including IAP, ETn and L1 elements. We found that many of the young KRAB-ZFPs present in the genomic clusters of KRAB-ZFPs on chromosomes 2 and 4, which are highly expressed in a restricted pattern in ES cells, bound redundantly to these three active TE families. In several cases, KRAB-ZFPs bound to functionally constrained sequence elements we and others have demonstrated to be necessary for retrotransposition, including PBS and viral packaging signals. Targeting such sequences may help the host defense system keep pace with rapidly evolving mouse transposons. This provides strong evidence that many young KRAB-ZFPs are indeed expanding in response to TE activity. But do these young KRAB-ZFP genes limit the mobilization of TEs? Despite the large number of polymorphic ETn elements in mouse strains (Nellåker et al., 2012) and several reports of phenotype-causing novel ETn germ line insertions, no new ETn insertions were reported in recent screens of C57BL/6 mouse genomes (Richardson et al., 2017; Gagnier et al., 2019), indicating that the overall rate of ETn germ line mobilization in inbred mice is rather low. We have demonstrated that Chr4-cl KRAB-ZFPs control ETn/ETnERV expression in ES cells, but this does not lead to widespread ETn mobility in viable C57BL/6 mice. In contrast, we found numerous novel, including several germ line, ETn insertions in both WT and Chr4-cl KO mice in a C57BL/6 129Sv mixed genetic background, with generally more insertions in KO mice and in mice with more 129Sv DNA. This is consistent with a report detecting ETn insertions in FVB.129 mice (Schauer et al., 2018). Notably, there was a large variation in the number of new insertions in these mice, possibly caused by hyperactive polymorphic ETn insertions that varied from individual to individual, epigenetic variation at ETn insertions between individuals and/or the general stochastic nature of ETn mobilization. Furthermore, recent reports have suggested that KRAB-ZFP gene content is distinct in different strains of laboratory mice (Lilue et al., 2018; Treger et al., 2019), and reduced KRAB-ZFP gene content could contribute to increased activity in individual mice. Although we have yet to find obvious phenotypes in the mice carrying new insertions, novel ETn germ line insertions have been shown to cause phenotypes from short tails (Lugani et al., 2013; Semba et al., 2013; Vlangos et al., 2013) to limb malformation (Kano et al., 2007) and severe morphogenetic defects including polypodia (Lehoczky et al., 2013) depending upon their insertion site.", + "text": "C2H2 zinc finger proteins, about half of which contain a KRAB repressor domain, represent the largest DNA-binding protein family in mammals. Nevertheless, most of these factors have not been investigated using loss-of-function studies. The most comprehensive characterization of human KRAB-ZFPs revealed a strong preference to bind TEs (Imbeault et al., 2017; Najafabadi et al., 2015) yet their function remains unknown. In humans, very few TEs are capable of retrotransposition yet many of them, often tens of million years old, are bound by KRAB-ZFPs. While this suggests that human KRAB-ZFPs mainly serve to control TE-borne enhancers and may have potentially transcription-independent functions, we were interested in the biological significance of KRAB-ZFPs in restricting potentially active TEs. The mouse is an ideal model for such studies since the mouse genome contains several active TE families, including IAP, ETn and L1 elements. We found that many of the young KRAB-ZFPs present in the genomic clusters of KRAB-ZFPs on chromosomes 2 and 4, which are highly expressed in a restricted pattern in ES cells, bound redundantly to these three active TE families. In several cases, KRAB-ZFPs bound to functionally constrained sequence elements we and others have demonstrated to be necessary for retrotransposition, including PBS and viral packaging signals. Targeting such sequences may help the host defense system keep pace with rapidly evolving mouse transposons. This provides strong evidence that many young KRAB-ZFPs are indeed expanding in response to TE activity. But do these young KRAB-ZFP genes limit the mobilization of TEs? Despite the large number of polymorphic ETn elements in mouse strains (Nellåker et al., 2012) and several reports of phenotype-causing novel ETn germ line insertions, no new ETn insertions were reported in recent screens of C57BL/6 mouse genomes (Richardson et al., 2017; Gagnier et al., 2019), indicating that the overall rate of ETn germ line mobilization in inbred mice is rather low. We have demonstrated that Chr4-cl KRAB-ZFPs control ETn/ETnERV expression in ES cells, but this does not lead to widespread ETn mobility in viable C57BL/6 mice. In contrast, we found numerous novel, including several germ line, ETn insertions in both WT and Chr4-cl KO mice in a C57BL/6 129Sv mixed genetic background, with generally more insertions in KO mice and in mice with more 129Sv DNA. This is consistent with a report detecting ETn insertions in FVB.129 mice (Schauer et al., 2018). Notably, there was a large variation in the number of new insertions in these mice, possibly caused by hyperactive polymorphic ETn insertions that varied from individual to individual, epigenetic variation at ETn insertions between individuals and/or the general stochastic nature of ETn mobilization. Furthermore, recent reports have suggested that KRAB-ZFP gene content is distinct in different strains of laboratory mice (Lilue et al., 2018; Treger et al., 2019), and reduced KRAB-ZFP gene content could contribute to increased activity in individual mice. Although we have yet to find obvious phenotypes in the mice carrying new insertions, novel ETn germ line insertions have been shown to cause phenotypes from short tails (Lugani et al., 2013; Semba et al., 2013; Vlangos et al., 2013) to limb malformation (Kano et al., 2007) and severe morphogenetic defects including polypodia (Lehoczky et al., 2013) depending upon their insertion site." + }, + { + "self_ref": "#/texts/50", + "parent": { + "$ref": "#/texts/48" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Despite a lack of widespread ETn activation in Chr4-cl KO mice, it still remains to be determined whether other TEs, like L1, IAP or other LTR retrotransposons are activated in any of the KRAB-ZFP cluster KO mice, which will require the development of additional capture-seq based assays. Notably, two of the heterozygous matings from Chr2-cl KO mice failed to produce viable knockout offspring, which could indicate a TE-reactivation phenotype. It may also be necessary to generate compound homozygous mutants of distinct KRAB-ZFP clusters to eliminate redundancy before TEs become unleashed. The KRAB-ZFP cluster knockouts produced here will be useful reagents to test such hypotheses. In sum, our data supports that a major driver of KRAB-ZFP gene expansion in mice is recent retrotransposon insertions, and that redundancy within the KRAB-ZFP gene family and with other TE restriction pathways provides protection against widespread TE mobility, explaining the non-essential function of the majority of KRAB-ZFP genes.", + "text": "Despite a lack of widespread ETn activation in Chr4-cl KO mice, it still remains to be determined whether other TEs, like L1, IAP or other LTR retrotransposons are activated in any of the KRAB-ZFP cluster KO mice, which will require the development of additional capture-seq based assays. Notably, two of the heterozygous matings from Chr2-cl KO mice failed to produce viable knockout offspring, which could indicate a TE-reactivation phenotype. It may also be necessary to generate compound homozygous mutants of distinct KRAB-ZFP clusters to eliminate redundancy before TEs become unleashed. The KRAB-ZFP cluster knockouts produced here will be useful reagents to test such hypotheses. In sum, our data supports that a major driver of KRAB-ZFP gene expansion in mice is recent retrotransposon insertions, and that redundancy within the KRAB-ZFP gene family and with other TE restriction pathways provides protection against widespread TE mobility, explaining the non-essential function of the majority of KRAB-ZFP genes." + }, + { + "self_ref": "#/texts/51", + "parent": { + "$ref": "#/texts/0" + }, + "children": [ + { + "$ref": "#/tables/1" + }, + { + "$ref": "#/texts/74" + }, + { + "$ref": "#/texts/78" + }, + { + "$ref": "#/texts/82" + }, + { + "$ref": "#/texts/88" + }, + { + "$ref": "#/texts/117" + }, + { + "$ref": "#/texts/121" + }, + { + "$ref": "#/texts/139" + }, + { + "$ref": "#/texts/141" + }, + { + "$ref": "#/texts/145" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Materials and methods", + "text": "Materials and methods", + "level": 1 + }, + { + "self_ref": "#/texts/52", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "caption", + "prov": [], + "orig": "Key resources table", + "text": "Key resources table" + }, + { + "self_ref": "#/texts/53", + "parent": { + "$ref": "#/groups/5" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ChIP (1 µg/10", + "text": "ChIP (1 µg/10" + }, + { + "self_ref": "#/texts/54", + "parent": { + "$ref": "#/groups/5" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "7", + "text": "7", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/55", + "parent": { + "$ref": "#/groups/5" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "cells)", + "text": "cells)" + }, + { + "self_ref": "#/texts/56", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ChIP (1 µg/10", + "text": "ChIP (1 µg/10" + }, + { + "self_ref": "#/texts/57", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "7", + "text": "7", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/58", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "cells)", + "text": "cells)" + }, + { + "self_ref": "#/texts/59", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ChIP (3 µl/10", + "text": "ChIP (3 µl/10" + }, + { + "self_ref": "#/texts/60", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "7", + "text": "7", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/61", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", "prov": [], - "orig": "ETn retrotransposition in Chr4-cl KO and WT mice", - "text": "ETn retrotransposition in Chr4-cl KO and WT mice", - "level": 2 + "orig": "cells)", + "text": "cells)" }, { - "self_ref": "#/texts/41", + "self_ref": "#/texts/62", "parent": { - "$ref": "#/texts/40" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "IAP, ETn/ETnERV and MuLV/RLTR4 retrotransposons are highly polymorphic in inbred mouse strains (Nellåker et al., 2012), indicating that these elements are able to mobilize in the germ line. Since these retrotransposons are upregulated in Chr2-cl and Chr4-cl KO ES cells, we speculated that these KRAB-ZFP clusters evolved to minimize the risks of insertional mutagenesis by retrotransposition. To test this, we generated Chr2-cl and Chr4-cl KO mice via ES cell injection into blastocysts, and after germ line transmission we genotyped the offspring of heterozygous breeding pairs. While the offspring of Chr4-cl KO/WT parents were born close to Mendelian ratios in pure C57BL/6 and mixed C57BL/6 129Sv matings, one Chr4-cl KO/WT breeding pair gave birth to significantly fewer KO mice than expected (p-value=0.022) (Figure 4—figure supplement 1A). Likewise, two out of four Chr2-cl KO breeding pairs on mixed C57BL/6 129Sv matings failed to give birth to a single KO offspring (p-value<0.01) while the two other mating pairs produced KO offspring at near Mendelian ratios (Figure 4—figure supplement 1A). Altogether, these data indicate that KRAB-ZFP clusters are not absolutely essential in mice, but that genetic and/or epigenetic factors may contribute to reduced viability.", - "text": "IAP, ETn/ETnERV and MuLV/RLTR4 retrotransposons are highly polymorphic in inbred mouse strains (Nellåker et al., 2012), indicating that these elements are able to mobilize in the germ line. Since these retrotransposons are upregulated in Chr2-cl and Chr4-cl KO ES cells, we speculated that these KRAB-ZFP clusters evolved to minimize the risks of insertional mutagenesis by retrotransposition. To test this, we generated Chr2-cl and Chr4-cl KO mice via ES cell injection into blastocysts, and after germ line transmission we genotyped the offspring of heterozygous breeding pairs. While the offspring of Chr4-cl KO/WT parents were born close to Mendelian ratios in pure C57BL/6 and mixed C57BL/6 129Sv matings, one Chr4-cl KO/WT breeding pair gave birth to significantly fewer KO mice than expected (p-value=0.022) (Figure 4—figure supplement 1A). Likewise, two out of four Chr2-cl KO breeding pairs on mixed C57BL/6 129Sv matings failed to give birth to a single KO offspring (p-value<0.01) while the two other mating pairs produced KO offspring at near Mendelian ratios (Figure 4—figure supplement 1A). Altogether, these data indicate that KRAB-ZFP clusters are not absolutely essential in mice, but that genetic and/or epigenetic factors may contribute to reduced viability." + "orig": "ChIP (1 µg/10", + "text": "ChIP (1 µg/10" }, { - "self_ref": "#/texts/42", + "self_ref": "#/texts/63", "parent": { - "$ref": "#/texts/40" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "We reasoned that retrotransposon activation could account for the reduced viability of Chr2-cl and Chr4-cl KO mice in some matings. However, since only rare matings produced non-viable KO embryos, we instead turned to the viable KO mice to assay for increased transposon activity. RNA-seq in blood, brain and testis revealed that, with a few exceptions, retrotransposons upregulated in Chr2 and Chr4 KRAB-ZFP cluster KO ES cells are not expressed at higher levels in adult tissues (Figure 4—figure supplement 1B). Likewise, no strong transcriptional TE reactivation phenotype was observed in liver and kidney of Chr4-cl KO mice (data not shown) and ChIP-seq with antibodies against H3K4me1, H3K4me3 and H3K27ac in testis of Chr4-cl WT and KO mice revealed no increase of active histone marks at ETn elements or other TEs (data not shown). This indicates that Chr2-cl and Chr4-cl KRAB-ZFPs are primarily required for TE repression during early development. This is consistent with the high expression of these KRAB-ZFPs uniquely in ES cells (Figure 1—figure supplement 1A). To determine whether retrotransposition occurs at a higher frequency in Chr4-cl KO mice during development, we screened for novel ETn (ETn/ETnERV) and MuLV (MuLV/RLTR4_MM) insertions in viable Chr4-cl KO mice. For this purpose, we developed a capture-sequencing approach to enrich for ETn/MuLV DNA and flanking sequences from genomic DNA using probes that hybridize with the 5’ and 3’ ends of ETn and MuLV LTRs prior to deep sequencing. We screened genomic DNA samples from a total of 76 mice, including 54 mice from ancestry-controlled Chr4-cl KO matings in various strain backgrounds, the two ES cell lines the Chr4-cl KO mice were generated from, and eight mice from a Chr2-cl KO mating which served as a control (since ETn and MuLVs are not activated in Chr2-cl KO ES cells) (Supplementary file 4). Using this approach, we were able to enrich reads mapping to ETn/MuLV LTRs about 2,000-fold compared to genome sequencing without capture. ETn/MuLV insertions were determined by counting uniquely mapped reads that were paired with reads mapping to ETn/MuLV elements (see materials and methods for details). To assess the efficiency of the capture approach, we determined what proportion of a set of 309 largely intact (two LTRs flanking an internal sequence) reference ETn elements could be identified using our sequencing data. 95% of these insertions were called with high confidence in the majority of our samples (data not shown), indicating that we are able to identify ETn insertions at a high recovery rate.", - "text": "We reasoned that retrotransposon activation could account for the reduced viability of Chr2-cl and Chr4-cl KO mice in some matings. However, since only rare matings produced non-viable KO embryos, we instead turned to the viable KO mice to assay for increased transposon activity. RNA-seq in blood, brain and testis revealed that, with a few exceptions, retrotransposons upregulated in Chr2 and Chr4 KRAB-ZFP cluster KO ES cells are not expressed at higher levels in adult tissues (Figure 4—figure supplement 1B). Likewise, no strong transcriptional TE reactivation phenotype was observed in liver and kidney of Chr4-cl KO mice (data not shown) and ChIP-seq with antibodies against H3K4me1, H3K4me3 and H3K27ac in testis of Chr4-cl WT and KO mice revealed no increase of active histone marks at ETn elements or other TEs (data not shown). This indicates that Chr2-cl and Chr4-cl KRAB-ZFPs are primarily required for TE repression during early development. This is consistent with the high expression of these KRAB-ZFPs uniquely in ES cells (Figure 1—figure supplement 1A). To determine whether retrotransposition occurs at a higher frequency in Chr4-cl KO mice during development, we screened for novel ETn (ETn/ETnERV) and MuLV (MuLV/RLTR4_MM) insertions in viable Chr4-cl KO mice. For this purpose, we developed a capture-sequencing approach to enrich for ETn/MuLV DNA and flanking sequences from genomic DNA using probes that hybridize with the 5’ and 3’ ends of ETn and MuLV LTRs prior to deep sequencing. We screened genomic DNA samples from a total of 76 mice, including 54 mice from ancestry-controlled Chr4-cl KO matings in various strain backgrounds, the two ES cell lines the Chr4-cl KO mice were generated from, and eight mice from a Chr2-cl KO mating which served as a control (since ETn and MuLVs are not activated in Chr2-cl KO ES cells) (Supplementary file 4). Using this approach, we were able to enrich reads mapping to ETn/MuLV LTRs about 2,000-fold compared to genome sequencing without capture. ETn/MuLV insertions were determined by counting uniquely mapped reads that were paired with reads mapping to ETn/MuLV elements (see materials and methods for details). To assess the efficiency of the capture approach, we determined what proportion of a set of 309 largely intact (two LTRs flanking an internal sequence) reference ETn elements could be identified using our sequencing data. 95% of these insertions were called with high confidence in the majority of our samples (data not shown), indicating that we are able to identify ETn insertions at a high recovery rate." + "orig": "7", + "text": "7", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/43", + "self_ref": "#/texts/64", "parent": { - "$ref": "#/texts/40" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Using this dataset, we first confirmed the polymorphic nature of both ETn and MuLV retrotransposons in laboratory mouse strains (Figure 4—figure supplement 2A), highlighting the potential of these elements to retrotranspose. To identify novel insertions, we filtered out insertions that were supported by ETn/MuLV-paired reads in more than one animal. While none of the 54 ancestry-controlled mice showed a single novel MuLV insertion, we observed greatly varying numbers of up to 80 novel ETn insertions in our pedigree (Figure 4A).", - "text": "Using this dataset, we first confirmed the polymorphic nature of both ETn and MuLV retrotransposons in laboratory mouse strains (Figure 4—figure supplement 2A), highlighting the potential of these elements to retrotranspose. To identify novel insertions, we filtered out insertions that were supported by ETn/MuLV-paired reads in more than one animal. While none of the 54 ancestry-controlled mice showed a single novel MuLV insertion, we observed greatly varying numbers of up to 80 novel ETn insertions in our pedigree (Figure 4A)." + "orig": "cells)", + "text": "cells)" }, { - "self_ref": "#/texts/44", + "self_ref": "#/texts/65", "parent": { - "$ref": "#/body" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", - "label": "caption", + "label": "text", "prov": [], - "orig": "Figure 4. ETn retrotransposition in Chr4-cl KO mice. (A) Pedigree of mice used for transposon insertion screening by capture-seq in mice of different strain backgrounds. The number of novel ETn insertions (only present in one animal) are indicated. For animals whose direct ancestors have not been screened, the ETn insertions are shown in parentheses since parental inheritance cannot be excluded in that case. Germ line insertions are indicated by asterisks. All DNA samples were prepared from tail tissues unless noted (-S: spleen, -E: ear, -B:Blood) (B) Statistical analysis of ETn insertion frequency in tail tissue from 30 Chr4-cl KO, KO/WT and WT mice that were derived from one Chr4-c KO x KO/WT and two Chr4-cl KO/WT x KO/WT matings. Only DNA samples that were collected from juvenile tails were considered for this analysis. P-values were calculated using one-sided Wilcoxon Rank Sum Test. In the last panel, KO, WT and KO/WT mice derived from all matings were combined for the statistical analysis.", - "text": "Figure 4. ETn retrotransposition in Chr4-cl KO mice. (A) Pedigree of mice used for transposon insertion screening by capture-seq in mice of different strain backgrounds. The number of novel ETn insertions (only present in one animal) are indicated. For animals whose direct ancestors have not been screened, the ETn insertions are shown in parentheses since parental inheritance cannot be excluded in that case. Germ line insertions are indicated by asterisks. All DNA samples were prepared from tail tissues unless noted (-S: spleen, -E: ear, -B:Blood) (B) Statistical analysis of ETn insertion frequency in tail tissue from 30 Chr4-cl KO, KO/WT and WT mice that were derived from one Chr4-c KO x KO/WT and two Chr4-cl KO/WT x KO/WT matings. Only DNA samples that were collected from juvenile tails were considered for this analysis. P-values were calculated using one-sided Wilcoxon Rank Sum Test. In the last panel, KO, WT and KO/WT mice derived from all matings were combined for the statistical analysis." + "orig": "ChIP (1 µg/10", + "text": "ChIP (1 µg/10" }, { - "self_ref": "#/texts/45", + "self_ref": "#/texts/66", "parent": { - "$ref": "#/texts/40" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "To validate some of the novel ETn insertions, we designed specific PCR primers for five of the insertions and screened genomic DNA of the mice in which they were identified as well as their parents. For all tested insertions, we were able to amplify their flanking sequence and show that these insertions are absent in their parents (Figure 4—figure supplement 3A). To confirm their identity, we amplified and sequenced three of the novel full-length ETn insertions. Two of these elements (Genbank accession: MH449667-68) resembled typical ETnII elements with identical 5’ and 3’ LTRs and target site duplications (TSD) of 4 or 6 bp, respectively. The third sequenced element (MH449669) represented a hybrid element that contains both ETnI and MusD (ETnERV) sequences. Similar insertions can be found in the B6 reference genome; however, the identified novel insertion has a 2.5 kb deletion of the 5’ end of the internal region. Additionally, the 5’ and 3’ LTR of this element differ in one nucleotide near the start site and contain an unusually large 248 bp TSD (containing a SINE repeat) indicating that an improper integration process might have truncated this element.", - "text": "To validate some of the novel ETn insertions, we designed specific PCR primers for five of the insertions and screened genomic DNA of the mice in which they were identified as well as their parents. For all tested insertions, we were able to amplify their flanking sequence and show that these insertions are absent in their parents (Figure 4—figure supplement 3A). To confirm their identity, we amplified and sequenced three of the novel full-length ETn insertions. Two of these elements (Genbank accession: MH449667-68) resembled typical ETnII elements with identical 5’ and 3’ LTRs and target site duplications (TSD) of 4 or 6 bp, respectively. The third sequenced element (MH449669) represented a hybrid element that contains both ETnI and MusD (ETnERV) sequences. Similar insertions can be found in the B6 reference genome; however, the identified novel insertion has a 2.5 kb deletion of the 5’ end of the internal region. Additionally, the 5’ and 3’ LTR of this element differ in one nucleotide near the start site and contain an unusually large 248 bp TSD (containing a SINE repeat) indicating that an improper integration process might have truncated this element." + "orig": "7", + "text": "7", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/46", + "self_ref": "#/texts/67", "parent": { - "$ref": "#/texts/40" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Besides novel ETn insertions that were only identified in one specific animal, we also observed three ETn insertions that could be detected in several siblings but not in their parents or any of the other screened mice. This strongly indicates that these retrotransposition events occurred in the germ line of the parents from which they were passed on to some of their offspring. One of these germ line insertions was evidently passed on from the offspring to the next generation (Figure 4A). As expected, the read numbers supporting these novel germ line insertions were comparable to the read numbers that were found in the flanking regions of annotated B6 ETn insertions (Figure 4—figure supplement 3B). In contrast, virtually all novel insertions that were only found in one animal were supported by significantly fewer reads (Figure 4—figure supplement 3B). This indicates that these elements resulted from retrotransposition events in the developing embryo and not in the zygote or parental germ cells. Indeed, we detected different sets of insertions in various tissues from the same animal (Figure 4—figure supplement 3C). Even between tail samples that were collected from the same animal at different ages, only a fraction of the new insertions were present in both samples, while technical replicates from the same genomic DNA samples showed a nearly complete overlap in insertions (Figure 4—figure supplement 3D).", - "text": "Besides novel ETn insertions that were only identified in one specific animal, we also observed three ETn insertions that could be detected in several siblings but not in their parents or any of the other screened mice. This strongly indicates that these retrotransposition events occurred in the germ line of the parents from which they were passed on to some of their offspring. One of these germ line insertions was evidently passed on from the offspring to the next generation (Figure 4A). As expected, the read numbers supporting these novel germ line insertions were comparable to the read numbers that were found in the flanking regions of annotated B6 ETn insertions (Figure 4—figure supplement 3B). In contrast, virtually all novel insertions that were only found in one animal were supported by significantly fewer reads (Figure 4—figure supplement 3B). This indicates that these elements resulted from retrotransposition events in the developing embryo and not in the zygote or parental germ cells. Indeed, we detected different sets of insertions in various tissues from the same animal (Figure 4—figure supplement 3C). Even between tail samples that were collected from the same animal at different ages, only a fraction of the new insertions were present in both samples, while technical replicates from the same genomic DNA samples showed a nearly complete overlap in insertions (Figure 4—figure supplement 3D)." + "orig": "cells)", + "text": "cells)" }, { - "self_ref": "#/texts/47", + "self_ref": "#/texts/68", "parent": { - "$ref": "#/texts/40" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Finally, we asked whether there were more novel ETn insertions in mice lacking the Chr4-cl relative to their wild type and heterozygous littermates in our pedigree. Interestingly, only one out of the eight Chr4-cl KO mice in a pure C57BL/6 strain background and none of the eight offspring from a Chr2-cl mating carried a single novel ETn insertion (Figure 4A). When crossing into a 129Sv background for a single generation before intercrossing heterozygous mice (F1), we observed 4 out of 8 Chr4-cl KO mice that contained at least one new ETn insertion, whereas none of 3 heterozygous mice contained any insertions. After crossing to the 129Sv background for a second generation (F2), we determined the number of novel ETn insertions in the offspring of one KO/WT x KO and two KO/WT x KO/WT matings, excluding all samples that were not derived from juvenile tail tissue. Only in the offspring of the KO/WT x KO mating, we observed a statistically significant higher average number of ETn insertions in KO vs. KO/WT animals (7.3 vs. 29.6, p=0.045, Figure 4B). Other than that, only a non-significant trend towards greater average numbers of ETn insertions in KO (11 vs. 27.8, p=0.192, Figure 4B) was apparent in one of the WT/KO x KO/WT matings whereas no difference in ETn insertion numbers between WT and KO mice could be observed in the second mating WT/KO x KO/WT (26 vs. 31, p=0.668, Figure 4B). When comparing all KO with all WT and WT/KO mice from these three matings, a trend towards more ETn insertions in KO remained but was not supported by strong significance (26 vs. 13, p=0.057, Figure 4B). Altogether, we observed a high variability in the number of new ETn insertions in both KO and WT but our data suggest that the Chr4-cl KRAB-ZFPs may have a modest effect on ETn retrotransposition rates in some mouse strains but other genetic and epigenetic effects clearly also play an important role.", - "text": "Finally, we asked whether there were more novel ETn insertions in mice lacking the Chr4-cl relative to their wild type and heterozygous littermates in our pedigree. Interestingly, only one out of the eight Chr4-cl KO mice in a pure C57BL/6 strain background and none of the eight offspring from a Chr2-cl mating carried a single novel ETn insertion (Figure 4A). When crossing into a 129Sv background for a single generation before intercrossing heterozygous mice (F1), we observed 4 out of 8 Chr4-cl KO mice that contained at least one new ETn insertion, whereas none of 3 heterozygous mice contained any insertions. After crossing to the 129Sv background for a second generation (F2), we determined the number of novel ETn insertions in the offspring of one KO/WT x KO and two KO/WT x KO/WT matings, excluding all samples that were not derived from juvenile tail tissue. Only in the offspring of the KO/WT x KO mating, we observed a statistically significant higher average number of ETn insertions in KO vs. KO/WT animals (7.3 vs. 29.6, p=0.045, Figure 4B). Other than that, only a non-significant trend towards greater average numbers of ETn insertions in KO (11 vs. 27.8, p=0.192, Figure 4B) was apparent in one of the WT/KO x KO/WT matings whereas no difference in ETn insertion numbers between WT and KO mice could be observed in the second mating WT/KO x KO/WT (26 vs. 31, p=0.668, Figure 4B). When comparing all KO with all WT and WT/KO mice from these three matings, a trend towards more ETn insertions in KO remained but was not supported by strong significance (26 vs. 13, p=0.057, Figure 4B). Altogether, we observed a high variability in the number of new ETn insertions in both KO and WT but our data suggest that the Chr4-cl KRAB-ZFPs may have a modest effect on ETn retrotransposition rates in some mouse strains but other genetic and epigenetic effects clearly also play an important role." + "orig": "ChIP (1 µg/10", + "text": "ChIP (1 µg/10" }, { - "self_ref": "#/texts/48", + "self_ref": "#/texts/69", "parent": { - "$ref": "#/texts/0" + "$ref": "#/groups/15" }, - "children": [ - { - "$ref": "#/texts/49" - }, - { - "$ref": "#/texts/50" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Discussion", - "text": "Discussion", - "level": 1 + "orig": "7", + "text": "7", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/49", + "self_ref": "#/texts/70", "parent": { - "$ref": "#/texts/48" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "C2H2 zinc finger proteins, about half of which contain a KRAB repressor domain, represent the largest DNA-binding protein family in mammals. Nevertheless, most of these factors have not been investigated using loss-of-function studies. The most comprehensive characterization of human KRAB-ZFPs revealed a strong preference to bind TEs (Imbeault et al., 2017; Najafabadi et al., 2015) yet their function remains unknown. In humans, very few TEs are capable of retrotransposition yet many of them, often tens of million years old, are bound by KRAB-ZFPs. While this suggests that human KRAB-ZFPs mainly serve to control TE-borne enhancers and may have potentially transcription-independent functions, we were interested in the biological significance of KRAB-ZFPs in restricting potentially active TEs. The mouse is an ideal model for such studies since the mouse genome contains several active TE families, including IAP, ETn and L1 elements. We found that many of the young KRAB-ZFPs present in the genomic clusters of KRAB-ZFPs on chromosomes 2 and 4, which are highly expressed in a restricted pattern in ES cells, bound redundantly to these three active TE families. In several cases, KRAB-ZFPs bound to functionally constrained sequence elements we and others have demonstrated to be necessary for retrotransposition, including PBS and viral packaging signals. Targeting such sequences may help the host defense system keep pace with rapidly evolving mouse transposons. This provides strong evidence that many young KRAB-ZFPs are indeed expanding in response to TE activity. But do these young KRAB-ZFP genes limit the mobilization of TEs? Despite the large number of polymorphic ETn elements in mouse strains (Nellåker et al., 2012) and several reports of phenotype-causing novel ETn germ line insertions, no new ETn insertions were reported in recent screens of C57BL/6 mouse genomes (Richardson et al., 2017; Gagnier et al., 2019), indicating that the overall rate of ETn germ line mobilization in inbred mice is rather low. We have demonstrated that Chr4-cl KRAB-ZFPs control ETn/ETnERV expression in ES cells, but this does not lead to widespread ETn mobility in viable C57BL/6 mice. In contrast, we found numerous novel, including several germ line, ETn insertions in both WT and Chr4-cl KO mice in a C57BL/6 129Sv mixed genetic background, with generally more insertions in KO mice and in mice with more 129Sv DNA. This is consistent with a report detecting ETn insertions in FVB.129 mice (Schauer et al., 2018). Notably, there was a large variation in the number of new insertions in these mice, possibly caused by hyperactive polymorphic ETn insertions that varied from individual to individual, epigenetic variation at ETn insertions between individuals and/or the general stochastic nature of ETn mobilization. Furthermore, recent reports have suggested that KRAB-ZFP gene content is distinct in different strains of laboratory mice (Lilue et al., 2018; Treger et al., 2019), and reduced KRAB-ZFP gene content could contribute to increased activity in individual mice. Although we have yet to find obvious phenotypes in the mice carrying new insertions, novel ETn germ line insertions have been shown to cause phenotypes from short tails (Lugani et al., 2013; Semba et al., 2013; Vlangos et al., 2013) to limb malformation (Kano et al., 2007) and severe morphogenetic defects including polypodia (Lehoczky et al., 2013) depending upon their insertion site.", - "text": "C2H2 zinc finger proteins, about half of which contain a KRAB repressor domain, represent the largest DNA-binding protein family in mammals. Nevertheless, most of these factors have not been investigated using loss-of-function studies. The most comprehensive characterization of human KRAB-ZFPs revealed a strong preference to bind TEs (Imbeault et al., 2017; Najafabadi et al., 2015) yet their function remains unknown. In humans, very few TEs are capable of retrotransposition yet many of them, often tens of million years old, are bound by KRAB-ZFPs. While this suggests that human KRAB-ZFPs mainly serve to control TE-borne enhancers and may have potentially transcription-independent functions, we were interested in the biological significance of KRAB-ZFPs in restricting potentially active TEs. The mouse is an ideal model for such studies since the mouse genome contains several active TE families, including IAP, ETn and L1 elements. We found that many of the young KRAB-ZFPs present in the genomic clusters of KRAB-ZFPs on chromosomes 2 and 4, which are highly expressed in a restricted pattern in ES cells, bound redundantly to these three active TE families. In several cases, KRAB-ZFPs bound to functionally constrained sequence elements we and others have demonstrated to be necessary for retrotransposition, including PBS and viral packaging signals. Targeting such sequences may help the host defense system keep pace with rapidly evolving mouse transposons. This provides strong evidence that many young KRAB-ZFPs are indeed expanding in response to TE activity. But do these young KRAB-ZFP genes limit the mobilization of TEs? Despite the large number of polymorphic ETn elements in mouse strains (Nellåker et al., 2012) and several reports of phenotype-causing novel ETn germ line insertions, no new ETn insertions were reported in recent screens of C57BL/6 mouse genomes (Richardson et al., 2017; Gagnier et al., 2019), indicating that the overall rate of ETn germ line mobilization in inbred mice is rather low. We have demonstrated that Chr4-cl KRAB-ZFPs control ETn/ETnERV expression in ES cells, but this does not lead to widespread ETn mobility in viable C57BL/6 mice. In contrast, we found numerous novel, including several germ line, ETn insertions in both WT and Chr4-cl KO mice in a C57BL/6 129Sv mixed genetic background, with generally more insertions in KO mice and in mice with more 129Sv DNA. This is consistent with a report detecting ETn insertions in FVB.129 mice (Schauer et al., 2018). Notably, there was a large variation in the number of new insertions in these mice, possibly caused by hyperactive polymorphic ETn insertions that varied from individual to individual, epigenetic variation at ETn insertions between individuals and/or the general stochastic nature of ETn mobilization. Furthermore, recent reports have suggested that KRAB-ZFP gene content is distinct in different strains of laboratory mice (Lilue et al., 2018; Treger et al., 2019), and reduced KRAB-ZFP gene content could contribute to increased activity in individual mice. Although we have yet to find obvious phenotypes in the mice carrying new insertions, novel ETn germ line insertions have been shown to cause phenotypes from short tails (Lugani et al., 2013; Semba et al., 2013; Vlangos et al., 2013) to limb malformation (Kano et al., 2007) and severe morphogenetic defects including polypodia (Lehoczky et al., 2013) depending upon their insertion site." + "orig": "cells)", + "text": "cells)" }, { - "self_ref": "#/texts/50", + "self_ref": "#/texts/71", "parent": { - "$ref": "#/texts/48" + "$ref": "#/groups/17" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Despite a lack of widespread ETn activation in Chr4-cl KO mice, it still remains to be determined whether other TEs, like L1, IAP or other LTR retrotransposons are activated in any of the KRAB-ZFP cluster KO mice, which will require the development of additional capture-seq based assays. Notably, two of the heterozygous matings from Chr2-cl KO mice failed to produce viable knockout offspring, which could indicate a TE-reactivation phenotype. It may also be necessary to generate compound homozygous mutants of distinct KRAB-ZFP clusters to eliminate redundancy before TEs become unleashed. The KRAB-ZFP cluster knockouts produced here will be useful reagents to test such hypotheses. In sum, our data supports that a major driver of KRAB-ZFP gene expansion in mice is recent retrotransposon insertions, and that redundancy within the KRAB-ZFP gene family and with other TE restriction pathways provides protection against widespread TE mobility, explaining the non-essential function of the majority of KRAB-ZFP genes.", - "text": "Despite a lack of widespread ETn activation in Chr4-cl KO mice, it still remains to be determined whether other TEs, like L1, IAP or other LTR retrotransposons are activated in any of the KRAB-ZFP cluster KO mice, which will require the development of additional capture-seq based assays. Notably, two of the heterozygous matings from Chr2-cl KO mice failed to produce viable knockout offspring, which could indicate a TE-reactivation phenotype. It may also be necessary to generate compound homozygous mutants of distinct KRAB-ZFP clusters to eliminate redundancy before TEs become unleashed. The KRAB-ZFP cluster knockouts produced here will be useful reagents to test such hypotheses. In sum, our data supports that a major driver of KRAB-ZFP gene expansion in mice is recent retrotransposon insertions, and that redundancy within the KRAB-ZFP gene family and with other TE restriction pathways provides protection against widespread TE mobility, explaining the non-essential function of the majority of KRAB-ZFP genes." + "orig": "ChIP (1 µg/10", + "text": "ChIP (1 µg/10" }, { - "self_ref": "#/texts/51", + "self_ref": "#/texts/72", "parent": { - "$ref": "#/texts/0" + "$ref": "#/groups/17" }, - "children": [ - { - "$ref": "#/tables/1" - }, - { - "$ref": "#/texts/53" - }, - { - "$ref": "#/texts/57" - }, - { - "$ref": "#/texts/61" - }, - { - "$ref": "#/texts/67" - }, - { - "$ref": "#/texts/96" - }, - { - "$ref": "#/texts/100" - }, - { - "$ref": "#/texts/118" - }, - { - "$ref": "#/texts/120" - }, - { - "$ref": "#/texts/124" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Materials and methods", - "text": "Materials and methods", - "level": 1 + "orig": "7", + "text": "7", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/52", + "self_ref": "#/texts/73", "parent": { - "$ref": "#/body" + "$ref": "#/groups/17" }, "children": [], "content_layer": "body", - "label": "caption", + "label": "text", "prov": [], - "orig": "Key resources table", - "text": "Key resources table" + "orig": "cells)", + "text": "cells)" }, { - "self_ref": "#/texts/53", + "self_ref": "#/texts/74", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/4" + "$ref": "#/groups/18" } ], "content_layer": "body", @@ -1600,9 +2139,9 @@ "level": 2 }, { - "self_ref": "#/texts/54", + "self_ref": "#/texts/75", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1612,9 +2151,9 @@ "text": "Mouse ES cells and F9 EC cells were cultivated as described previously (Wolf et al., 2015b) unless stated otherwise. Chr4-cl KO ES cells originate from B6;129‐ Gt(ROSA)26Sortm1(cre/ERT)Nat/J mice (Jackson lab), all other KRAB-ZFP cluster KO ES cell lines originate from JM8A3.N1 C57BL/6N-A" }, { - "self_ref": "#/texts/55", + "self_ref": "#/texts/76", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1631,9 +2170,9 @@ } }, { - "self_ref": "#/texts/56", + "self_ref": "#/texts/77", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1643,13 +2182,13 @@ "text": "ES cells (KOMP Repository). Chr2-cl KO and WT ES cells were initially grown in serum-containing media (Wolf et al., 2015b) but changed to 2i media (De Iaco et al., 2017) for several weeks before analysis. To generate Chr4-cl and Chr2-cl KO mice, the cluster deletions were repeated in B6 ES (KOMP repository) or R1 (Nagy lab) ES cells, respectively, and heterozygous clones were injected into B6 albino blastocysts. Chr2-cl KO mice were therefore kept on a mixed B6/Svx129/Sv-CP strain background while Chr4-cl KO mice were initially derived on a pure C57BL/6 background. For capture-seq screens, Chr4-cl KO mice were crossed with 129 × 1/SvJ mice (Jackson lab) to produce the founder mice for Chr4-cl KO and WT (B6/129 F1) offspring. Chr4-cl KO/WT (B6/129 F1) were also crossed with 129 × 1/SvJ mice to get Chr4-cl KO/WT (B6/129 F1) mice, which were intercrossed to give rise to the parents of Chr4-cl KO/KO and KO/WT (B6/129 F2) offspring." }, { - "self_ref": "#/texts/57", + "self_ref": "#/texts/78", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/5" + "$ref": "#/groups/19" } ], "content_layer": "body", @@ -1660,9 +2199,9 @@ "level": 2 }, { - "self_ref": "#/texts/58", + "self_ref": "#/texts/79", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/19" }, "children": [], "content_layer": "body", @@ -1672,9 +2211,9 @@ "text": "KRAB-ZFP ORFs were PCR-amplified from cDNA or synthesized with codon-optimization (Supplementary file 1), and stably expressed with 3XFLAG or 3XHA tags in F9 EC or ES cells using" }, { - "self_ref": "#/texts/59", + "self_ref": "#/texts/80", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/19" }, "children": [], "content_layer": "body", @@ -1691,9 +2230,9 @@ } }, { - "self_ref": "#/texts/60", + "self_ref": "#/texts/81", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/19" }, "children": [], "content_layer": "body", @@ -1703,13 +2242,13 @@ "text": "transposon-based (Wolf et al., 2015b) or lentiviral expression vectors (Imbeault et al., 2017; Supplementary file 1). Cells were selected with puromycin (1 µg/ml) and resistant clones were pooled and further expanded for ChIP-seq." }, { - "self_ref": "#/texts/61", + "self_ref": "#/texts/82", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/6" + "$ref": "#/groups/20" } ], "content_layer": "body", @@ -1720,9 +2259,9 @@ "level": 2 }, { - "self_ref": "#/texts/62", + "self_ref": "#/texts/83", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1732,9 +2271,9 @@ "text": "All gRNAs were expressed from the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (RRID:" }, { - "self_ref": "#/texts/63", + "self_ref": "#/texts/84", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1745,9 +2284,9 @@ "hyperlink": "https://scicrunch.org/resolver/Addgene_42230" }, { - "self_ref": "#/texts/64", + "self_ref": "#/texts/85", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1757,9 +2296,9 @@ "text": ") and nucleofected into 10" }, { - "self_ref": "#/texts/65", + "self_ref": "#/texts/86", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1776,9 +2315,9 @@ } }, { - "self_ref": "#/texts/66", + "self_ref": "#/texts/87", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1788,16 +2327,16 @@ "text": "ES cells using Amaxa nucleofection in the following amounts: 5 µg of each pX330-gRNA plasmid, 1 µg pPGK-puro and 500 pmoles single-stranded repair oligos (Supplementary file 3). One day after nucleofection, cells were kept under puromycin selection (1 µg/ml) for 24 hr. Individual KO and WT clones were picked 7–8 days after nucleofection and expanded for PCR genotyping (Supplementary file 3)." }, { - "self_ref": "#/texts/67", + "self_ref": "#/texts/88", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, { - "$ref": "#/groups/8" + "$ref": "#/groups/22" } ], "content_layer": "body", @@ -1808,9 +2347,9 @@ "level": 2 }, { - "self_ref": "#/texts/68", + "self_ref": "#/texts/89", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1820,9 +2359,9 @@ "text": "For ChIP-seq analysis of KRAB-ZFP expressing cells, 5–10 × 10" }, { - "self_ref": "#/texts/69", + "self_ref": "#/texts/90", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1839,9 +2378,9 @@ } }, { - "self_ref": "#/texts/70", + "self_ref": "#/texts/91", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1851,9 +2390,9 @@ "text": "cells were crosslinked and immunoprecipitated with anti-FLAG (Sigma-Aldrich Cat# F1804, RRID:" }, { - "self_ref": "#/texts/71", + "self_ref": "#/texts/92", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1864,9 +2403,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_262044" }, { - "self_ref": "#/texts/72", + "self_ref": "#/texts/93", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1876,9 +2415,9 @@ "text": ") or anti-HA (Abcam Cat# ab9110, RRID:" }, { - "self_ref": "#/texts/73", + "self_ref": "#/texts/94", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1889,9 +2428,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_307019" }, { - "self_ref": "#/texts/74", + "self_ref": "#/texts/95", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1901,9 +2440,9 @@ "text": "or Covance Cat# MMS-101P-200, RRID:" }, { - "self_ref": "#/texts/75", + "self_ref": "#/texts/96", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1914,9 +2453,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_10064068" }, { - "self_ref": "#/texts/76", + "self_ref": "#/texts/97", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1926,9 +2465,9 @@ "text": ") antibody using one of two previously described protocols (O'Geen et al., 2010; Imbeault et al., 2017) as indicated in Supplementary file 1. H3K9me3 distribution in Chr4-cl, Chr10-cl, Chr13.1-cl and Chr13.2-cl KO ES cells was determined by native ChIP-seq with anti-H3K9me3 serum (Active Motif Cat# 39161, RRID:" }, { - "self_ref": "#/texts/77", + "self_ref": "#/texts/98", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1939,9 +2478,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_2532132" }, { - "self_ref": "#/texts/78", + "self_ref": "#/texts/99", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1951,9 +2490,9 @@ "text": ") as described previously (Karimi et al., 2011). In Chr2-cl KO ES cells, H3K9me3 and KAP1 ChIP-seq was performed as previously described (Ecco et al., 2016). In Chr4-cl KO and WT ES cells KAP1 binding was determined by endogenous tagging of KAP1 with C-terminal GFP (Supplementary file 3), followed by FACS to enrich for GFP-positive cells and ChIP with anti-GFP (Thermo Fisher Scientific Cat# A-11122, RRID:" }, { - "self_ref": "#/texts/79", + "self_ref": "#/texts/100", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1964,9 +2503,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_221569" }, { - "self_ref": "#/texts/80", + "self_ref": "#/texts/101", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1976,9 +2515,9 @@ "text": ") using a previously described protocol (O'Geen et al., 2010). For ChIP-seq analysis of active histone marks, cross-linked chromatin from ES cells or testis (from two-week old mice) was immunoprecipitated with antibodies against H3K4me3 (Abcam Cat# ab8580, RRID:" }, { - "self_ref": "#/texts/81", + "self_ref": "#/texts/102", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -1989,9 +2528,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_306649" }, { - "self_ref": "#/texts/82", + "self_ref": "#/texts/103", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -2001,9 +2540,9 @@ "text": "), H3K4me1 (Abcam Cat# ab8895, RRID:" }, { - "self_ref": "#/texts/83", + "self_ref": "#/texts/104", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -2014,9 +2553,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_306847" }, { - "self_ref": "#/texts/84", + "self_ref": "#/texts/105", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -2026,9 +2565,9 @@ "text": ") and H3K27ac (Abcam Cat# ab4729, RRID:" }, { - "self_ref": "#/texts/85", + "self_ref": "#/texts/106", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -2039,9 +2578,9 @@ "hyperlink": "https://scicrunch.org/resolver/AB_2118291" }, { - "self_ref": "#/texts/86", + "self_ref": "#/texts/107", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/21" }, "children": [], "content_layer": "body", @@ -2051,9 +2590,9 @@ "text": ") following the protocol developed by O'Geen et al., 2010 or Khil et al., 2012 respectively." }, { - "self_ref": "#/texts/87", + "self_ref": "#/texts/108", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2063,9 +2602,9 @@ "text": "ChIP-seq libraries were constructed and sequenced as indicated in Supplementary file 4. Reads were mapped to the mm9 genome using Bowtie (RRID:" }, { - "self_ref": "#/texts/88", + "self_ref": "#/texts/109", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2076,9 +2615,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_005476" }, { - "self_ref": "#/texts/89", + "self_ref": "#/texts/110", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2088,9 +2627,9 @@ "text": "; settings: --best) or Bowtie2 (Langmead and Salzberg, 2012) as indicated in Supplementary file 4. Under these settings, reads that map to multiple genomic regions are assigned to the top-scored match and, if a set of equally good choices is encountered, a pseudo-random number is used to choose one location. Peaks were called using MACS14 (RRID:" }, { - "self_ref": "#/texts/90", + "self_ref": "#/texts/111", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2101,9 +2640,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_013291" }, { - "self_ref": "#/texts/91", + "self_ref": "#/texts/112", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2113,9 +2652,9 @@ "text": ") under high stringency settings (p<1e-10, peak enrichment >20) (Zhang et al., 2008). Peaks were called both over the Input control and a FLAG or HA control ChIP (unless otherwise stated in Supplementary file 4) and only peaks that were called in both settings were kept for further analysis. In cases when the stringency settings did not result in at least 50 peaks, the settings were changed to medium (p<1e-10, peak enrichment >10) or low (p<1e-5, peak enrichment >10) stringency (Supplementary file 4). For further analysis, all peaks were scaled to 200 bp regions centered around the peak summits. The overlap of the scaled peaks to each repeat element in UCSC Genome Browser (RRID:" }, { - "self_ref": "#/texts/92", + "self_ref": "#/texts/113", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2126,9 +2665,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_005780" }, { - "self_ref": "#/texts/93", + "self_ref": "#/texts/114", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2138,9 +2677,9 @@ "text": ") were calculated by using the bedfisher function (settings: -f 0.25) from BEDTools (RRID:" }, { - "self_ref": "#/texts/94", + "self_ref": "#/texts/115", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2151,9 +2690,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_006646" }, { - "self_ref": "#/texts/95", + "self_ref": "#/texts/116", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -2163,13 +2702,13 @@ "text": "). The right-tailed p-values between pair-wise comparison of each ChIP-seq peak and repeat element were extracted, and then adjusted using the Benjamini-Hochberg approach implemented in the R function p.adjust(). Binding motifs were determined using only nonrepetitive (<10% repeat content) peaks with MEME (Bailey et al., 2009). MEME motifs were compared with in silico predicted motifs (Najafabadi et al., 2015) using Tomtom (Bailey et al., 2009) and considered as significantly overlapping with a False Discovery Rate (FDR) below 0.1. To find MEME and predicted motifs in repetitive peaks, we used FIMO (Bailey et al., 2009). Differential H3K9me3 and KAP1 distribution in WT and Chr2-cl or Chr4-cl KO ES cells at TEs was determined by counting ChIP-seq reads overlapping annotated insertions of each TE group using BEDTools (MultiCovBed). Additionally, ChIP-seq reads were counted at the TE fraction that was bound by Chr2-cl or Chr4-cl KRAB-ZFPs (overlapping with 200 bp peaks). Count tables were concatenated and analyzed using DESeq2 (Love et al., 2014). The previously published ChIP-seq datasets for KAP1 (Castro-Diaz et al., 2014) and H3K9me3 (Dan et al., 2014) were re-mapped using Bowtie (--best)." }, { - "self_ref": "#/texts/96", + "self_ref": "#/texts/117", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/9" + "$ref": "#/groups/23" } ], "content_layer": "body", @@ -2180,9 +2719,9 @@ "level": 2 }, { - "self_ref": "#/texts/97", + "self_ref": "#/texts/118", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/23" }, "children": [], "content_layer": "body", @@ -2192,9 +2731,9 @@ "text": "For KRAB-ZFP repression assays, double-stranded DNA oligos containing KRAB-ZFP target sequences (Supplementary file 3) were cloned upstream of the SV40 promoter of the pGL3-Promoter vector (Promega) between the restriction sites for NheI and XhoI. 33 ng of reporter vectors were co-transfected (Lipofectamine 2000, Thermofisher) with 33 ng pRL-SV40 (Promega) for normalization and 33 ng of transient KRAB-ZFP expression vectors (in pcDNA3.1) or empty pcDNA3.1 into 293 T cells seeded one day earlier in 96-well plates. Cells were lysed 48 hr after transfection and luciferase/Renilla luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega). To measure the transcriptional activity of the MMETn element upstream of the" }, { - "self_ref": "#/texts/98", + "self_ref": "#/texts/119", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/23" }, "children": [], "content_layer": "body", @@ -2211,9 +2750,9 @@ } }, { - "self_ref": "#/texts/99", + "self_ref": "#/texts/120", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/23" }, "children": [], "content_layer": "body", @@ -2223,13 +2762,13 @@ "text": "gene, fragments of varying sizes (Supplementary file 3) were cloned into the promoter-less pGL3-basic vector (Promega) using NheI and NcoI sites. 70 ng of reporter vectors were cotransfected with 30 ng pRL-SV40 into feeder-depleted Chr4-cl WT and KO ES cells, seeded into a gelatinized 96-well plate 2 hr before transfection. Luciferase activity was measured 48 hr after transfection as described above." }, { - "self_ref": "#/texts/100", + "self_ref": "#/texts/121", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/10" + "$ref": "#/groups/24" } ], "content_layer": "body", @@ -2240,9 +2779,9 @@ "level": 2 }, { - "self_ref": "#/texts/101", + "self_ref": "#/texts/122", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2252,9 +2791,9 @@ "text": "Whole RNA was purified using RNeasy columns (Qiagen) with on column DNase treatment or the High Pure RNA Isolation Kit (Roche) (Supplementary file 4). Tissues were first lysed in TRIzol reagent (ThermoFisher) and RNA was purified after the isopropanol precipitation step using RNeasy columns (Qiagen) with on column DNase treatment. Libraries were generated using the SureSelect Strand-Specific RNA Library Prep kit (Agilent) or Illumina’s TruSeq RNA Library Prep Kit (with polyA selection) and sequenced as 50 or 100 bp paired-end reads on an Illumina HiSeq2500 (RRID:" }, { - "self_ref": "#/texts/102", + "self_ref": "#/texts/123", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2265,9 +2804,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_016383" }, { - "self_ref": "#/texts/103", + "self_ref": "#/texts/124", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2277,9 +2816,9 @@ "text": ") or HiSeq3000 (RRID:" }, { - "self_ref": "#/texts/104", + "self_ref": "#/texts/125", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2290,9 +2829,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_016386" }, { - "self_ref": "#/texts/105", + "self_ref": "#/texts/126", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2302,9 +2841,9 @@ "text": ") machine (Supplementary file 4). RNA-seq reads were mapped to the mouse genome (mm9) using Tophat (RRID:" }, { - "self_ref": "#/texts/106", + "self_ref": "#/texts/127", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2315,9 +2854,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_013035" }, { - "self_ref": "#/texts/107", + "self_ref": "#/texts/128", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2327,9 +2866,9 @@ "text": "; settings: --I 200000 g 1) unless otherwise stated. These settings allow each mappable read to be reported once, in case the read maps to multiple locations equally well, one match is randomly chosen. For differential transposon expression, mapped reads that overlap with TEs annotated in Repeatmasker (RRID:" }, { - "self_ref": "#/texts/108", + "self_ref": "#/texts/129", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2340,9 +2879,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_012954" }, { - "self_ref": "#/texts/109", + "self_ref": "#/texts/130", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2352,9 +2891,9 @@ "text": ") were counted using BEDTools MultiCovBed (setting: -split). Reads mapping to multiple fragments that belong to the same TE insertion (as indicated by the repeat ID) were summed up. Only transposons with a total of at least 20 (for two biological replicates) or 30 (for three biological replicates) mapped reads across WT and KO samples were considered for differential expression analysis. Transposons within the deleted KRAB-ZFP cluster were excluded from the analysis. Read count tables were used for differential expression analysis with DESeq2 (RRID:" }, { - "self_ref": "#/texts/110", + "self_ref": "#/texts/131", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2365,9 +2904,9 @@ "hyperlink": "https://scicrunch.org/resolver/SCR_015687" }, { - "self_ref": "#/texts/111", + "self_ref": "#/texts/132", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2377,9 +2916,9 @@ "text": "). For differential gene expression analysis, reads overlapping with gene exons were counted using HTSeq-count and analyzed using DESeq2. To test if KRAB-ZFP peaks are significantly enriched near up- or down-regulated genes, a binomial test was performed. Briefly, the proportion of the peaks that are located within a certain distance up- or downstream to the TSS of genes was determined using the windowBed function of BED tools. The probability" }, { - "self_ref": "#/texts/112", + "self_ref": "#/texts/133", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2396,9 +2935,9 @@ } }, { - "self_ref": "#/texts/113", + "self_ref": "#/texts/134", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2408,9 +2947,9 @@ "text": "in the binomial distribution was estimated as the fraction of all genes overlapped with KRAB-ZFP peaks. Then, given" }, { - "self_ref": "#/texts/114", + "self_ref": "#/texts/135", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2427,9 +2966,9 @@ } }, { - "self_ref": "#/texts/115", + "self_ref": "#/texts/136", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2439,9 +2978,9 @@ "text": "which is the number of specific groups of genes, and" }, { - "self_ref": "#/texts/116", + "self_ref": "#/texts/137", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2458,9 +2997,9 @@ } }, { - "self_ref": "#/texts/117", + "self_ref": "#/texts/138", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -2470,13 +3009,13 @@ "text": "which is the number of this group of genes overlapped with peaks, the R function binom.test() was used to estimate the p-value based on right-tailed Binomial test. Finally, the adjusted p-values were determined separately for LTR and LINE retrotransposon groups using the Benjamini-Hochberg approach implemented in the R function p.adjust()." }, { - "self_ref": "#/texts/118", + "self_ref": "#/texts/139", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/texts/119" + "$ref": "#/texts/140" } ], "content_layer": "body", @@ -2487,9 +3026,9 @@ "level": 2 }, { - "self_ref": "#/texts/119", + "self_ref": "#/texts/140", "parent": { - "$ref": "#/texts/118" + "$ref": "#/texts/139" }, "children": [], "content_layer": "body", @@ -2499,13 +3038,13 @@ "text": "For RRBS-seq analysis, Chr4-cl WT and KO ES cells were grown in either standard ES cell media containing FCS or for one week in 2i media containing vitamin C as described previously (Blaschke et al., 2013). Genomic DNA was purified from WT and Chr4-cl KO ES cells using the Quick-gDNA purification kit (Zymo Research) and bisulfite-converted with the NEXTflex Bisulfite-Seq Kit (Bio Scientific) using Msp1 digestion to fragment DNA. Libraries were sequenced as 50 bp paired-end reads on an Illumina HiSeq. The reads were processed using Trim Galore (--illumina --paired –rrbs) to trim poor quality bases and adaptors. Additionally, the first 5 nt of R2 and the last 3 nt of R1 and R2 were trimmed. Reads were then mapped to the reference genome (mm9) using Bismark (Krueger and Andrews, 2011) to extract methylation calling results. The CpG methylation pattern for each covered CpG dyads (two complementary CG dinucleotides) was calculated using a custom script (Source code 1: get_CpG_ML.pl). For comparison of CpG methylation between WT and Chr4-cl KO ES cells (in serum or 2i + Vitamin C conditions) only CpG sites with at least 10-fold coverage in each sample were considered for analysis." }, { - "self_ref": "#/texts/120", + "self_ref": "#/texts/141", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/11" + "$ref": "#/groups/25" } ], "content_layer": "body", @@ -2516,9 +3055,9 @@ "level": 2 }, { - "self_ref": "#/texts/121", + "self_ref": "#/texts/142", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/25" }, "children": [], "content_layer": "body", @@ -2528,9 +3067,9 @@ "text": "The retrotransposition vectors pCMV-MusD2, pCMV-MusD2-neoTNF and pCMV-ETnI1-neoTNF (Ribet et al., 2004) were a kind gift from Dixie Mager. To partially delete the Gm13051 binding site within pCMV-MusD2-neoTNF, the vector was cut with KpnI and re-ligated using a repair oligo, leaving a 24 bp deletion within the Gm13051 binding site. The Rex2 binding site in pCMV-ETnI1-neoTNF was deleted by cutting the vector with EcoRI and XbaI followed by re-ligation using two overlapping PCR products, leaving a 45 bp deletion while maintaining the rest of the vector unchanged (see Supplementary file 3 for primer sequences). For MusD retrotransposition assays, 5 × 10" }, { - "self_ref": "#/texts/122", + "self_ref": "#/texts/143", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/25" }, "children": [], "content_layer": "body", @@ -2547,9 +3086,9 @@ } }, { - "self_ref": "#/texts/123", + "self_ref": "#/texts/144", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/25" }, "children": [], "content_layer": "body", @@ -2559,13 +3098,13 @@ "text": "HeLa cells (ATCC CCL-2) were transfected in a 24-well dish with 100 ng pCMV-MusD2-neoTNF or pCMV-MusD2-neoTNF (ΔGm13051-m) using Lipofectamine 2000. For ETn retrotransposition assays, 50 ng of pCMV-ETnI1-neoTNF or pCMV-ETnI1-neoTNF (ΔRex2) vectors were cotransfected with 50 ng pCMV-MusD2 to provide gag and pol proteins in trans. G418 (0.6 mg/ml) was added five days after transfection and cells were grown under selection until colonies were readily visible by eye. G418-resistant colonies were stained with Amido Black (Sigma)." }, { - "self_ref": "#/texts/124", + "self_ref": "#/texts/145", "parent": { "$ref": "#/texts/51" }, "children": [ { - "$ref": "#/groups/12" + "$ref": "#/groups/26" } ], "content_layer": "body", @@ -2576,9 +3115,9 @@ "level": 2 }, { - "self_ref": "#/texts/125", + "self_ref": "#/texts/146", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/26" }, "children": [], "content_layer": "body", @@ -2588,9 +3127,9 @@ "text": "To identify novel retrotransposon insertions, genomic DNA from various tissues (Supplementary file 4) was purified and used for library construction with target enrichment using the SureSelect" }, { - "self_ref": "#/texts/126", + "self_ref": "#/texts/147", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/26" }, "children": [], "content_layer": "body", @@ -2607,9 +3146,9 @@ } }, { - "self_ref": "#/texts/127", + "self_ref": "#/texts/148", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/26" }, "children": [], "content_layer": "body", @@ -2619,16 +3158,16 @@ "text": "Target Enrichment kit (Agilent). Custom RNA capture probes were designed to hybridize with the 120 bp 5’ ends of the 5’ LTRs and the 120 bp 3’ ends of the 3’ LTR of about 600 intact (internal region flanked by two LTRs) MMETn/RLTRETN retrotransposons or of 140 RLTR4_MM/RLTR4 retrotransposons that were upregulated in Chr4-cl KO ES cells (Figure 4—source data 2). Enriched libraries were sequenced on an Illumina HiSeq as paired-end 50 bp reads. R1 and R2 reads were mapped to the mm9 genome separately, using settings that only allow non-duplicated, uniquely mappable reads (Bowtie -m 1 --best --strata; samtools rmdup -s) and under settings that allow multimapping and duplicated reads (Bowtie --best). Of the latter, only reads that overlap (min. 50% of read) with RLTRETN, MMETn-int, ETnERV-int, ETnERV2-int or ETnERV3-int repeats (ETn) or RLTR4, RLTR4_MM-int or MuLV-int repeats (RLTR4) were kept. Only uniquely mappable reads whose paired reads were overlapping with the repeats mentioned above were used for further analysis. All ETn- and RLTR4-paired reads were then clustered (as bed files) using BEDTools (bedtools merge -i -n -d 1000) to receive a list of all potential annotated and non-annotated new ETn or RLTR4 insertion sites and all overlapping ETn- or RLTR4-paired reads were counted for each sample at each locus. Finally, all regions that were located within 1 kb of an annotated RLTRETN, MMETn-int, ETnERV-int, ETnERV2-int or ETnERV3-int repeat as well as regions overlapping with previously identified polymorphic ETn elements (Nellåker et al., 2012) were removed. Genomic loci with at least 10 reads per million unique ETn- or RLTR4-paired reads were considered as insertion sites. To qualify for a de-novo insertion, we allowed no called insertions in any of the other screened mice at the locus and not a single read at the locus in the ancestors of the mouse. Insertions at the same locus in at least two siblings from the same offspring were considered as germ line insertions, if the insertion was absent in the parents and mice who were not direct descendants from these siblings. Full-length sequencing of new ETn insertions was done by Sanger sequencing of short PCR products in combination with Illumina sequencing of a large PCR product (Supplementary file 3), followed by de-novo assembly using the Unicycler software." }, { - "self_ref": "#/texts/128", + "self_ref": "#/texts/149", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/129" + "$ref": "#/texts/150" }, { - "$ref": "#/groups/13" + "$ref": "#/groups/27" } ], "content_layer": "body", @@ -2639,9 +3178,9 @@ "level": 1 }, { - "self_ref": "#/texts/129", + "self_ref": "#/texts/150", "parent": { - "$ref": "#/texts/128" + "$ref": "#/texts/149" }, "children": [], "content_layer": "body", @@ -2651,9 +3190,9 @@ "text": "This paper was supported by the following grants:" }, { - "self_ref": "#/texts/130", + "self_ref": "#/texts/151", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/27" }, "children": [], "content_layer": "body", @@ -2665,9 +3204,9 @@ "marker": "" }, { - "self_ref": "#/texts/131", + "self_ref": "#/texts/152", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/27" }, "children": [], "content_layer": "body", @@ -2679,9 +3218,9 @@ "marker": "" }, { - "self_ref": "#/texts/132", + "self_ref": "#/texts/153", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/27" }, "children": [], "content_layer": "body", @@ -2693,9 +3232,9 @@ "marker": "" }, { - "self_ref": "#/texts/133", + "self_ref": "#/texts/154", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/27" }, "children": [], "content_layer": "body", @@ -2707,9 +3246,9 @@ "marker": "" }, { - "self_ref": "#/texts/134", + "self_ref": "#/texts/155", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/27" }, "children": [], "content_layer": "body", @@ -2721,13 +3260,13 @@ "marker": "" }, { - "self_ref": "#/texts/135", + "self_ref": "#/texts/156", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/136" + "$ref": "#/texts/157" } ], "content_layer": "body", @@ -2738,9 +3277,9 @@ "level": 1 }, { - "self_ref": "#/texts/136", + "self_ref": "#/texts/157", "parent": { - "$ref": "#/texts/135" + "$ref": "#/texts/156" }, "children": [], "content_layer": "body", @@ -2750,19 +3289,19 @@ "text": "We thank Alex Grinberg, Jeanne Yimdjo and Victoria Carter for generating and maintaining transgenic mice. We also thank members of the Macfarlan and Trono labs for useful discussion, Steven Coon, James Iben, Tianwei Li and Anna Malawska for NGS and computational support. This work was supported by NIH grant 1ZIAHD008933 and the NIH DDIR Innovation Award program (TSM), and by subsidies from the Swiss National Science Foundation (310030_152879 and 310030B_173337) and the European Research Council (KRABnKAP, No. 268721; Transpos-X, No. 694658) (DT)." }, { - "self_ref": "#/texts/137", + "self_ref": "#/texts/158", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/138" + "$ref": "#/texts/159" }, { - "$ref": "#/texts/141" + "$ref": "#/texts/162" }, { - "$ref": "#/texts/162" + "$ref": "#/texts/183" } ], "content_layer": "body", @@ -2773,13 +3312,13 @@ "level": 1 }, { - "self_ref": "#/texts/138", + "self_ref": "#/texts/159", "parent": { - "$ref": "#/texts/137" + "$ref": "#/texts/158" }, "children": [ { - "$ref": "#/groups/14" + "$ref": "#/groups/28" } ], "content_layer": "body", @@ -2790,13 +3329,13 @@ "level": 2 }, { - "self_ref": "#/texts/139", + "self_ref": "#/texts/160", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/28" }, "children": [ { - "$ref": "#/texts/140" + "$ref": "#/texts/161" } ], "content_layer": "body", @@ -2808,9 +3347,9 @@ "marker": "" }, { - "self_ref": "#/texts/140", + "self_ref": "#/texts/161", "parent": { - "$ref": "#/texts/139" + "$ref": "#/texts/160" }, "children": [], "content_layer": "body", @@ -2820,13 +3359,13 @@ "text": "No competing interests declared." }, { - "self_ref": "#/texts/141", + "self_ref": "#/texts/162", "parent": { - "$ref": "#/texts/137" + "$ref": "#/texts/158" }, "children": [ { - "$ref": "#/groups/15" + "$ref": "#/groups/29" } ], "content_layer": "body", @@ -2837,13 +3376,13 @@ "level": 2 }, { - "self_ref": "#/texts/142", + "self_ref": "#/texts/163", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/143" + "$ref": "#/texts/164" } ], "content_layer": "body", @@ -2855,9 +3394,9 @@ "marker": "" }, { - "self_ref": "#/texts/143", + "self_ref": "#/texts/164", "parent": { - "$ref": "#/texts/142" + "$ref": "#/texts/163" }, "children": [], "content_layer": "body", @@ -2867,13 +3406,13 @@ "text": "Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing - original draft." }, { - "self_ref": "#/texts/144", + "self_ref": "#/texts/165", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/145" + "$ref": "#/texts/166" } ], "content_layer": "body", @@ -2885,9 +3424,9 @@ "marker": "" }, { - "self_ref": "#/texts/145", + "self_ref": "#/texts/166", "parent": { - "$ref": "#/texts/144" + "$ref": "#/texts/165" }, "children": [], "content_layer": "body", @@ -2897,13 +3436,13 @@ "text": "Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing - original draft, Writing - review and editing." }, { - "self_ref": "#/texts/146", + "self_ref": "#/texts/167", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/147" + "$ref": "#/texts/168" } ], "content_layer": "body", @@ -2915,9 +3454,9 @@ "marker": "" }, { - "self_ref": "#/texts/147", + "self_ref": "#/texts/168", "parent": { - "$ref": "#/texts/146" + "$ref": "#/texts/167" }, "children": [], "content_layer": "body", @@ -2927,13 +3466,13 @@ "text": "Conceptualization, Data curation, Software, Formal analysis, Investigation, Visualization, Methodology, Writing - review and editing." }, { - "self_ref": "#/texts/148", + "self_ref": "#/texts/169", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/149" + "$ref": "#/texts/170" } ], "content_layer": "body", @@ -2945,9 +3484,9 @@ "marker": "" }, { - "self_ref": "#/texts/149", + "self_ref": "#/texts/170", "parent": { - "$ref": "#/texts/148" + "$ref": "#/texts/169" }, "children": [], "content_layer": "body", @@ -2957,13 +3496,13 @@ "text": "Conceptualization, Formal analysis, Investigation, Writing - review and editing." }, { - "self_ref": "#/texts/150", + "self_ref": "#/texts/171", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/151" + "$ref": "#/texts/172" } ], "content_layer": "body", @@ -2975,9 +3514,9 @@ "marker": "" }, { - "self_ref": "#/texts/151", + "self_ref": "#/texts/172", "parent": { - "$ref": "#/texts/150" + "$ref": "#/texts/171" }, "children": [], "content_layer": "body", @@ -2987,13 +3526,13 @@ "text": "Investigation." }, { - "self_ref": "#/texts/152", + "self_ref": "#/texts/173", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/153" + "$ref": "#/texts/174" } ], "content_layer": "body", @@ -3005,9 +3544,9 @@ "marker": "" }, { - "self_ref": "#/texts/153", + "self_ref": "#/texts/174", "parent": { - "$ref": "#/texts/152" + "$ref": "#/texts/173" }, "children": [], "content_layer": "body", @@ -3017,13 +3556,13 @@ "text": "Investigation." }, { - "self_ref": "#/texts/154", + "self_ref": "#/texts/175", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/155" + "$ref": "#/texts/176" } ], "content_layer": "body", @@ -3035,9 +3574,9 @@ "marker": "" }, { - "self_ref": "#/texts/155", + "self_ref": "#/texts/176", "parent": { - "$ref": "#/texts/154" + "$ref": "#/texts/175" }, "children": [], "content_layer": "body", @@ -3047,13 +3586,13 @@ "text": "Data curation, Software, Formal analysis, Visualization." }, { - "self_ref": "#/texts/156", + "self_ref": "#/texts/177", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/157" + "$ref": "#/texts/178" } ], "content_layer": "body", @@ -3065,9 +3604,9 @@ "marker": "" }, { - "self_ref": "#/texts/157", + "self_ref": "#/texts/178", "parent": { - "$ref": "#/texts/156" + "$ref": "#/texts/177" }, "children": [], "content_layer": "body", @@ -3077,13 +3616,13 @@ "text": "Investigation." }, { - "self_ref": "#/texts/158", + "self_ref": "#/texts/179", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/159" + "$ref": "#/texts/180" } ], "content_layer": "body", @@ -3095,9 +3634,9 @@ "marker": "" }, { - "self_ref": "#/texts/159", + "self_ref": "#/texts/180", "parent": { - "$ref": "#/texts/158" + "$ref": "#/texts/179" }, "children": [], "content_layer": "body", @@ -3107,13 +3646,13 @@ "text": "Conceptualization, Resources, Supervision, Funding acquisition, Investigation, Writing - review and editing." }, { - "self_ref": "#/texts/160", + "self_ref": "#/texts/181", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/161" + "$ref": "#/texts/182" } ], "content_layer": "body", @@ -3125,9 +3664,9 @@ "marker": "" }, { - "self_ref": "#/texts/161", + "self_ref": "#/texts/182", "parent": { - "$ref": "#/texts/160" + "$ref": "#/texts/181" }, "children": [], "content_layer": "body", @@ -3137,13 +3676,13 @@ "text": "Conceptualization, Resources, Supervision, Funding acquisition, Investigation, Methodology, Writing - original draft, Project administration, Writing - review and editing." }, { - "self_ref": "#/texts/162", + "self_ref": "#/texts/183", "parent": { - "$ref": "#/texts/137" + "$ref": "#/texts/158" }, "children": [ { - "$ref": "#/groups/16" + "$ref": "#/groups/30" } ], "content_layer": "body", @@ -3154,13 +3693,13 @@ "level": 2 }, { - "self_ref": "#/texts/163", + "self_ref": "#/texts/184", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/30" }, "children": [ { - "$ref": "#/texts/164" + "$ref": "#/texts/185" } ], "content_layer": "body", @@ -3172,9 +3711,9 @@ "marker": "" }, { - "self_ref": "#/texts/164", + "self_ref": "#/texts/185", "parent": { - "$ref": "#/texts/163" + "$ref": "#/texts/184" }, "children": [], "content_layer": "body", @@ -3184,7 +3723,7 @@ "text": "Animal experimentation: All studies using mice were performed in accordance to the Guide for the Care and Use of Laboratory Animals of the NIH, under IACUC animal protocol (ASP )18-026." }, { - "self_ref": "#/texts/165", + "self_ref": "#/texts/186", "parent": { "$ref": "#/texts/0" }, @@ -3197,37 +3736,37 @@ "level": 1 }, { - "self_ref": "#/texts/166", + "self_ref": "#/texts/187", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/167" + "$ref": "#/texts/188" }, { - "$ref": "#/texts/168" + "$ref": "#/texts/189" }, { - "$ref": "#/texts/169" + "$ref": "#/texts/190" }, { - "$ref": "#/texts/170" + "$ref": "#/texts/191" }, { - "$ref": "#/texts/171" + "$ref": "#/texts/192" }, { - "$ref": "#/texts/172" + "$ref": "#/texts/193" }, { - "$ref": "#/texts/173" + "$ref": "#/texts/194" }, { - "$ref": "#/texts/174" + "$ref": "#/texts/195" }, { - "$ref": "#/texts/175" + "$ref": "#/texts/196" } ], "content_layer": "body", @@ -3238,9 +3777,9 @@ "level": 1 }, { - "self_ref": "#/texts/167", + "self_ref": "#/texts/188", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3250,9 +3789,9 @@ "text": "All NGS data has been deposited in GEO (GSE115291). Sequences of full-length de novo ETn insertions have been deposited in the GenBank database (MH449667- MH449669)." }, { - "self_ref": "#/texts/168", + "self_ref": "#/texts/189", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3262,9 +3801,9 @@ "text": "The following datasets were generated:" }, { - "self_ref": "#/texts/169", + "self_ref": "#/texts/190", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3274,9 +3813,9 @@ "text": "Wolf G. Retrotransposon reactivation and mobilization upon deletions of megabase scale KRAB zinc finger gene clusters in mice. NCBI Gene Expression Omnibus (2019). NCBI: GSE115291" }, { - "self_ref": "#/texts/170", + "self_ref": "#/texts/191", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3286,9 +3825,9 @@ "text": "Wolf G. Mus musculus musculus strain C57BL/6x129X1/SvJ retrotransposon MMETn-int, complete sequence. NCBI GenBank (2019). NCBI: MH449667" }, { - "self_ref": "#/texts/171", + "self_ref": "#/texts/192", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3298,9 +3837,9 @@ "text": "Wolf G. Mus musculus musculus strain C57BL/6x129X1/SvJ retrotransposon MMETn-int, complete sequence. NCBI GenBank (2019). NCBI: MH449668" }, { - "self_ref": "#/texts/172", + "self_ref": "#/texts/193", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3310,9 +3849,9 @@ "text": "Wolf G. Mus musculus musculus strain C57BL/6x129X1/SvJ retrotransposon MMETn-int, complete sequence. NCBI GenBank (2019). NCBI: MH449669" }, { - "self_ref": "#/texts/173", + "self_ref": "#/texts/194", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3322,9 +3861,9 @@ "text": "The following previously published datasets were used:" }, { - "self_ref": "#/texts/174", + "self_ref": "#/texts/195", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3334,9 +3873,9 @@ "text": "Castro-Diaz N, Ecco G, Coluccio A, Kapopoulou A, Duc J, Trono D. Evollutionally dynamic L1 regulation in embryonic stem cells. NCBI Gene Expression Omnibus (2014). NCBI: GSM1406445" }, { - "self_ref": "#/texts/175", + "self_ref": "#/texts/196", "parent": { - "$ref": "#/texts/166" + "$ref": "#/texts/187" }, "children": [], "content_layer": "body", @@ -3346,13 +3885,13 @@ "text": "Andrew ZX. H3K9me3_ChIPSeq (Ctrl). NCBI Gene Expression Omnibus (2014). NCBI: GSM1327148" }, { - "self_ref": "#/texts/176", + "self_ref": "#/texts/197", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/groups/17" + "$ref": "#/groups/31" } ], "content_layer": "body", @@ -3363,9 +3902,9 @@ "level": 1 }, { - "self_ref": "#/texts/177", + "self_ref": "#/texts/198", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3377,9 +3916,9 @@ "marker": "" }, { - "self_ref": "#/texts/178", + "self_ref": "#/texts/199", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3391,9 +3930,9 @@ "marker": "" }, { - "self_ref": "#/texts/179", + "self_ref": "#/texts/200", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3405,9 +3944,9 @@ "marker": "" }, { - "self_ref": "#/texts/180", + "self_ref": "#/texts/201", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3419,9 +3958,9 @@ "marker": "" }, { - "self_ref": "#/texts/181", + "self_ref": "#/texts/202", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3433,9 +3972,9 @@ "marker": "" }, { - "self_ref": "#/texts/182", + "self_ref": "#/texts/203", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3447,9 +3986,9 @@ "marker": "" }, { - "self_ref": "#/texts/183", + "self_ref": "#/texts/204", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3461,9 +4000,9 @@ "marker": "" }, { - "self_ref": "#/texts/184", + "self_ref": "#/texts/205", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3475,9 +4014,9 @@ "marker": "" }, { - "self_ref": "#/texts/185", + "self_ref": "#/texts/206", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3489,9 +4028,9 @@ "marker": "" }, { - "self_ref": "#/texts/186", + "self_ref": "#/texts/207", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3503,9 +4042,9 @@ "marker": "" }, { - "self_ref": "#/texts/187", + "self_ref": "#/texts/208", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3517,9 +4056,9 @@ "marker": "" }, { - "self_ref": "#/texts/188", + "self_ref": "#/texts/209", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3531,9 +4070,9 @@ "marker": "" }, { - "self_ref": "#/texts/189", + "self_ref": "#/texts/210", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3545,9 +4084,9 @@ "marker": "" }, { - "self_ref": "#/texts/190", + "self_ref": "#/texts/211", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3559,9 +4098,9 @@ "marker": "" }, { - "self_ref": "#/texts/191", + "self_ref": "#/texts/212", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3573,9 +4112,9 @@ "marker": "" }, { - "self_ref": "#/texts/192", + "self_ref": "#/texts/213", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3587,9 +4126,9 @@ "marker": "" }, { - "self_ref": "#/texts/193", + "self_ref": "#/texts/214", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3601,9 +4140,9 @@ "marker": "" }, { - "self_ref": "#/texts/194", + "self_ref": "#/texts/215", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3615,9 +4154,9 @@ "marker": "" }, { - "self_ref": "#/texts/195", + "self_ref": "#/texts/216", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3629,9 +4168,9 @@ "marker": "" }, { - "self_ref": "#/texts/196", + "self_ref": "#/texts/217", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3643,9 +4182,9 @@ "marker": "" }, { - "self_ref": "#/texts/197", + "self_ref": "#/texts/218", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3657,9 +4196,9 @@ "marker": "" }, { - "self_ref": "#/texts/198", + "self_ref": "#/texts/219", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3671,9 +4210,9 @@ "marker": "" }, { - "self_ref": "#/texts/199", + "self_ref": "#/texts/220", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3685,9 +4224,9 @@ "marker": "" }, { - "self_ref": "#/texts/200", + "self_ref": "#/texts/221", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3699,9 +4238,9 @@ "marker": "" }, { - "self_ref": "#/texts/201", + "self_ref": "#/texts/222", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3713,9 +4252,9 @@ "marker": "" }, { - "self_ref": "#/texts/202", + "self_ref": "#/texts/223", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3727,9 +4266,9 @@ "marker": "" }, { - "self_ref": "#/texts/203", + "self_ref": "#/texts/224", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3741,9 +4280,9 @@ "marker": "" }, { - "self_ref": "#/texts/204", + "self_ref": "#/texts/225", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3755,9 +4294,9 @@ "marker": "" }, { - "self_ref": "#/texts/205", + "self_ref": "#/texts/226", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3769,9 +4308,9 @@ "marker": "" }, { - "self_ref": "#/texts/206", + "self_ref": "#/texts/227", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3783,9 +4322,9 @@ "marker": "" }, { - "self_ref": "#/texts/207", + "self_ref": "#/texts/228", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3797,9 +4336,9 @@ "marker": "" }, { - "self_ref": "#/texts/208", + "self_ref": "#/texts/229", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3811,9 +4350,9 @@ "marker": "" }, { - "self_ref": "#/texts/209", + "self_ref": "#/texts/230", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3825,9 +4364,9 @@ "marker": "" }, { - "self_ref": "#/texts/210", + "self_ref": "#/texts/231", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3839,9 +4378,9 @@ "marker": "" }, { - "self_ref": "#/texts/211", + "self_ref": "#/texts/232", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3853,9 +4392,9 @@ "marker": "" }, { - "self_ref": "#/texts/212", + "self_ref": "#/texts/233", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3867,9 +4406,9 @@ "marker": "" }, { - "self_ref": "#/texts/213", + "self_ref": "#/texts/234", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3881,9 +4420,9 @@ "marker": "" }, { - "self_ref": "#/texts/214", + "self_ref": "#/texts/235", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3895,9 +4434,9 @@ "marker": "" }, { - "self_ref": "#/texts/215", + "self_ref": "#/texts/236", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3909,9 +4448,9 @@ "marker": "" }, { - "self_ref": "#/texts/216", + "self_ref": "#/texts/237", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3923,9 +4462,9 @@ "marker": "" }, { - "self_ref": "#/texts/217", + "self_ref": "#/texts/238", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3937,9 +4476,9 @@ "marker": "" }, { - "self_ref": "#/texts/218", + "self_ref": "#/texts/239", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3951,9 +4490,9 @@ "marker": "" }, { - "self_ref": "#/texts/219", + "self_ref": "#/texts/240", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3965,9 +4504,9 @@ "marker": "" }, { - "self_ref": "#/texts/220", + "self_ref": "#/texts/241", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3979,9 +4518,9 @@ "marker": "" }, { - "self_ref": "#/texts/221", + "self_ref": "#/texts/242", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -3993,9 +4532,9 @@ "marker": "" }, { - "self_ref": "#/texts/222", + "self_ref": "#/texts/243", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4007,9 +4546,9 @@ "marker": "" }, { - "self_ref": "#/texts/223", + "self_ref": "#/texts/244", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4021,9 +4560,9 @@ "marker": "" }, { - "self_ref": "#/texts/224", + "self_ref": "#/texts/245", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4035,9 +4574,9 @@ "marker": "" }, { - "self_ref": "#/texts/225", + "self_ref": "#/texts/246", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4049,9 +4588,9 @@ "marker": "" }, { - "self_ref": "#/texts/226", + "self_ref": "#/texts/247", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4063,9 +4602,9 @@ "marker": "" }, { - "self_ref": "#/texts/227", + "self_ref": "#/texts/248", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4077,9 +4616,9 @@ "marker": "" }, { - "self_ref": "#/texts/228", + "self_ref": "#/texts/249", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4091,9 +4630,9 @@ "marker": "" }, { - "self_ref": "#/texts/229", + "self_ref": "#/texts/250", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4105,9 +4644,9 @@ "marker": "" }, { - "self_ref": "#/texts/230", + "self_ref": "#/texts/251", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4119,9 +4658,9 @@ "marker": "" }, { - "self_ref": "#/texts/231", + "self_ref": "#/texts/252", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -4133,9 +4672,9 @@ "marker": "" }, { - "self_ref": "#/texts/232", + "self_ref": "#/texts/253", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/31" }, "children": [], "content_layer": "body", @@ -5442,7 +5981,29 @@ "parent": { "$ref": "#/texts/51" }, - "children": [], + "children": [ + { + "$ref": "#/groups/4" + }, + { + "$ref": "#/groups/6" + }, + { + "$ref": "#/groups/8" + }, + { + "$ref": "#/groups/10" + }, + { + "$ref": "#/groups/12" + }, + { + "$ref": "#/groups/14" + }, + { + "$ref": "#/groups/16" + } + ], "content_layer": "body", "label": "table", "prov": [], @@ -5973,7 +6534,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/4" + } }, { "row_span": 1, @@ -6038,7 +6602,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/6" + } }, { "row_span": 1, @@ -6168,7 +6735,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/8" + } }, { "row_span": 1, @@ -6233,7 +6803,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/10" + } }, { "row_span": 1, @@ -6298,7 +6871,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/12" + } }, { "row_span": 1, @@ -6363,7 +6939,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/14" + } }, { "row_span": 1, @@ -6428,7 +7007,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/16" + } }, { "row_span": 1, diff --git a/tests/data/jats/groundtruth/elife-56337.nxml.md b/tests/data/jats/groundtruth/elife-56337.nxml.md index 0eb9c186a9..08abc9b23b 100644 --- a/tests/data/jats/groundtruth/elife-56337.nxml.md +++ b/tests/data/jats/groundtruth/elife-56337.nxml.md @@ -99,14 +99,14 @@ Key resources table | Cell line (Mus musculus) | B6;129‐ Gt(ROSA)26Sortm1(cre/ERT)Nat/J | The Jackson Laboratory | 004847 | ES cells used to generate KO cell lines and mice | | Cell line (Mus musculus) | R1 ES cells | Andras Nagy lab | R1 | 129 ES cells used to generate KO cell lines and mice | | Cell line (Mus musculus) | F9 Embryonic carcinoma cells | ATCC | ATCC CRL-1720 | | -| Antibody | Mouse monoclonal ANTI-FLAG M2 antibody | Sigma-Aldrich | Cat# F1804, RRID:AB_262044 | ChIP (1 µg/107 cells) | -| Antibody | Rabbit polyclonal anti-HA | Abcam | Cat# ab9110, RRID:AB_307019 | ChIP (1 µg/107 cells) | +| Antibody | Mouse monoclonal ANTI-FLAG M2 antibody | Sigma-Aldrich | Cat# F1804, RRID:AB_262044 | ChIP (1 µg/10 7 cells) | +| Antibody | Rabbit polyclonal anti-HA | Abcam | Cat# ab9110, RRID:AB_307019 | ChIP (1 µg/10 7 cells) | | Antibody | Mouse monoclonal anti-HA | Covance | Cat# MMS-101P-200, RRID:AB_10064068 | | -| Antibody | Rabbit polyclonal anti-H3K9me3 | Active Motif | Cat# 39161, RRID:AB_2532132 | ChIP (3 µl/107 cells) | -| Antibody | Rabbit polyclonal anti-GFP | Thermo Fisher Scientific | Cat# A-11122, RRID:AB_221569 | ChIP (1 µg/107 cells) | -| Antibody | Rabbit polyclonal anti- H3K4me3 | Abcam | Cat# ab8580, RRID:AB_306649 | ChIP (1 µg/107 cells) | -| Antibody | Rabbit polyclonal anti- H3K4me1 | Abcam | Cat# ab8895, RRID:AB_306847 | ChIP (1 µg/107 cells) | -| Antibody | Rabbit polyclonal anti- H3K27ac | Abcam | Cat# ab4729, RRID:AB_2118291 | ChIP (1 µg/107 cells) | +| Antibody | Rabbit polyclonal anti-H3K9me3 | Active Motif | Cat# 39161, RRID:AB_2532132 | ChIP (3 µl/10 7 cells) | +| Antibody | Rabbit polyclonal anti-GFP | Thermo Fisher Scientific | Cat# A-11122, RRID:AB_221569 | ChIP (1 µg/10 7 cells) | +| Antibody | Rabbit polyclonal anti- H3K4me3 | Abcam | Cat# ab8580, RRID:AB_306649 | ChIP (1 µg/10 7 cells) | +| Antibody | Rabbit polyclonal anti- H3K4me1 | Abcam | Cat# ab8895, RRID:AB_306847 | ChIP (1 µg/10 7 cells) | +| Antibody | Rabbit polyclonal anti- H3K27ac | Abcam | Cat# ab4729, RRID:AB_2118291 | ChIP (1 µg/10 7 cells) | | Recombinant DNA reagent | pCW57.1 | Addgene | RRID:Addgene_41393 | Inducible lentiviral expression vector | | Recombinant DNA reagent | pX330-U6-Chimeric_BB-CBh-hSpCas9 | Addgene | RRID:Addgene_42230 | CRISPR/Cas9 expression construct | | Sequence-based reagent | Chr2-cl KO gRNA.1 | This paper | Cas9 gRNA | GCCGTTGCTCAGTCCAAATG | diff --git a/tests/data/jats/groundtruth/pntd.0008301.nxml.itxt b/tests/data/jats/groundtruth/pntd.0008301.nxml.itxt index c02654ddaa..4d56117e3a 100644 --- a/tests/data/jats/groundtruth/pntd.0008301.nxml.itxt +++ b/tests/data/jats/groundtruth/pntd.0008301.nxml.itxt @@ -23,195 +23,203 @@ item-0 at level 0: unspecified: group _root_ item-22 at level 3: text: Building on previous work, we de ... available global geospatial data sets. item-23 at level 3: table with [18x8] item-23 at level 4: caption: Table 1 Categorization of potential factors influencing pre-TAS results. - item-24 at level 3: section_header: Data sources - item-25 at level 4: text: Information on baseline prevalen ... publicly available sources (Table 1). - item-26 at level 3: section_header: Outcome and covariate variables - item-27 at level 4: text: The outcome of interest for this ... r than or equal to 1% Mf or 2% Ag [4]. - item-28 at level 4: inline: group group - item-29 at level 5: text: Potential covariates were derive ... ous variables were derived from either - item-30 at level 5: text: a priori - item-31 at level 5: text: knowledge or through exploratory ... is and the final categorizations used. - item-32 at level 4: section_header: Baseline prevalence - item-33 at level 5: text: Baseline prevalence can be assum ... (2) using the cut-off of <10% or ≥10%. - item-34 at level 4: section_header: Agent - item-35 at level 5: inline: group group - item-36 at level 6: text: In terms of differences in trans ... mics by agent, research has shown that - item-37 at level 6: text: Brugia - item-38 at level 6: text: spp. are more susceptible to the anti-filarial drug regimens than - item-39 at level 6: text: Wuchereria bancrofti - item-40 at level 6: text: parasites [23]. Thus, we combined districts reporting - item-41 at level 6: text: B - item-42 at level 6: text: . - item-43 at level 6: text: malayi - item-44 at level 6: text: and - item-45 at level 6: text: B - item-46 at level 6: text: . - item-47 at level 6: text: timori - item-48 at level 6: text: and compared them to areas with - item-49 at level 6: text: W + item-24 at level 4: unspecified: group rich_cell_group_1_3_6 + item-25 at level 5: inline: group group + item-26 at level 6: text: Area measured in km + item-27 at level 6: text: 2 + item-28 at level 4: unspecified: group rich_cell_group_1_3_9 + item-29 at level 5: inline: group group + item-30 at level 6: text: Number of people per km + item-31 at level 6: text: 2 + item-32 at level 3: section_header: Data sources + item-33 at level 4: text: Information on baseline prevalen ... publicly available sources (Table 1). + item-34 at level 3: section_header: Outcome and covariate variables + item-35 at level 4: text: The outcome of interest for this ... r than or equal to 1% Mf or 2% Ag [4]. + item-36 at level 4: inline: group group + item-37 at level 5: text: Potential covariates were derive ... ous variables were derived from either + item-38 at level 5: text: a priori + item-39 at level 5: text: knowledge or through exploratory ... is and the final categorizations used. + item-40 at level 4: section_header: Baseline prevalence + item-41 at level 5: text: Baseline prevalence can be assum ... (2) using the cut-off of <10% or ≥10%. + item-42 at level 4: section_header: Agent + item-43 at level 5: inline: group group + item-44 at level 6: text: In terms of differences in trans ... mics by agent, research has shown that + item-45 at level 6: text: Brugia + item-46 at level 6: text: spp. are more susceptible to the anti-filarial drug regimens than + item-47 at level 6: text: Wuchereria bancrofti + item-48 at level 6: text: parasites [23]. Thus, we combined districts reporting + item-49 at level 6: text: B item-50 at level 6: text: . - item-51 at level 6: text: bancrofti - item-52 at level 6: text: or mixed parasites. Two variable ... e were variables delineating vectors ( - item-53 at level 6: text: Anopheles - item-54 at level 6: text: or - item-55 at level 6: text: Mansonia - item-56 at level 6: text: compared to - item-57 at level 6: text: Culex - item-58 at level 6: text: ) from the environmental domain ... dazole (DEC-ALB)] from the MDA domain. - item-59 at level 4: section_header: Environment - item-60 at level 5: text: LF transmission intensity is inf ... dicates a higher level of “greenness.” - item-61 at level 5: inline: group group - item-62 at level 6: text: We included the socio-economic v ... countries LF is mostly transmitted by - item-63 at level 6: text: Culex - item-64 at level 6: text: in urban areas and by - item-65 at level 6: text: Anopheles - item-66 at level 6: text: in rural areas [32]. Additionall ... proxy for socio-economic status [33]. - item-67 at level 5: text: Finally, all or parts of distric ... s were co-endemic with onchocerciasis. - item-68 at level 4: section_header: MDA - item-69 at level 5: text: Treatment effectiveness depends ... esent a threat to elimination [41,42]. - item-70 at level 5: text: We considered three approaches w ... unds ever documented in that district. - item-71 at level 4: section_header: Pre-TAS implementation - item-72 at level 5: text: Pre-TAS results can be influence ... d throughout the time period of study. - item-73 at level 3: section_header: Data inclusion criteria - item-74 at level 4: text: The dataset, summarized at the d ... al analysis dataset had 554 districts. - item-75 at level 3: section_header: Statistical analysis and modeling - item-76 at level 4: text: Statistical analysis and modelin ... d the number of variables accordingly. - item-77 at level 4: inline: group group - item-78 at level 5: text: Sensitivity analysis was perform ... ica, (3) including only districts with - item-79 at level 5: text: W - item-80 at level 5: text: . - item-81 at level 5: text: bancrofti - item-82 at level 5: text: parasite, and (4) including only districts with - item-83 at level 5: text: Anopheles - item-84 at level 5: text: as the primary vector. The sensi ... ot have been truly LF-endemic [43,44]. - item-85 at level 2: section_header: Results - item-86 at level 3: text: The overall pre-TAS pass rate fo ... ts had baseline prevalences below 20%. - item-87 at level 3: picture - item-87 at level 4: caption: Fig 1 Number of pre-TAS by country. - item-88 at level 3: picture - item-88 at level 4: caption: Fig 2 District-level baseline prevalence by country. - item-89 at level 3: inline: group group - item-90 at level 4: text: Fig 3 shows the unadjusted analy ... FTS diagnostic test, primary vector of - item-91 at level 4: text: Culex - item-92 at level 4: text: , treatment with DEC-ALB, higher ... overage, and sufficient rounds of MDA. - item-93 at level 3: picture - item-93 at level 4: caption: Fig 3 Percent pre-TAS failure by each characteristic (unadjusted). - item-94 at level 3: text: The final log-binomial model inc ... igh baseline and diagnostic test used. - item-95 at level 3: text: Fig 4 shows the risk ratio resul ... of failing pre-TAS (95% CI 1.95–4.83). + item-51 at level 6: text: malayi + item-52 at level 6: text: and + item-53 at level 6: text: B + item-54 at level 6: text: . + item-55 at level 6: text: timori + item-56 at level 6: text: and compared them to areas with + item-57 at level 6: text: W + item-58 at level 6: text: . + item-59 at level 6: text: bancrofti + item-60 at level 6: text: or mixed parasites. Two variable ... e were variables delineating vectors ( + item-61 at level 6: text: Anopheles + item-62 at level 6: text: or + item-63 at level 6: text: Mansonia + item-64 at level 6: text: compared to + item-65 at level 6: text: Culex + item-66 at level 6: text: ) from the environmental domain ... dazole (DEC-ALB)] from the MDA domain. + item-67 at level 4: section_header: Environment + item-68 at level 5: text: LF transmission intensity is inf ... dicates a higher level of “greenness.” + item-69 at level 5: inline: group group + item-70 at level 6: text: We included the socio-economic v ... countries LF is mostly transmitted by + item-71 at level 6: text: Culex + item-72 at level 6: text: in urban areas and by + item-73 at level 6: text: Anopheles + item-74 at level 6: text: in rural areas [32]. Additionall ... proxy for socio-economic status [33]. + item-75 at level 5: text: Finally, all or parts of distric ... s were co-endemic with onchocerciasis. + item-76 at level 4: section_header: MDA + item-77 at level 5: text: Treatment effectiveness depends ... esent a threat to elimination [41,42]. + item-78 at level 5: text: We considered three approaches w ... unds ever documented in that district. + item-79 at level 4: section_header: Pre-TAS implementation + item-80 at level 5: text: Pre-TAS results can be influence ... d throughout the time period of study. + item-81 at level 3: section_header: Data inclusion criteria + item-82 at level 4: text: The dataset, summarized at the d ... al analysis dataset had 554 districts. + item-83 at level 3: section_header: Statistical analysis and modeling + item-84 at level 4: text: Statistical analysis and modelin ... d the number of variables accordingly. + item-85 at level 4: inline: group group + item-86 at level 5: text: Sensitivity analysis was perform ... ica, (3) including only districts with + item-87 at level 5: text: W + item-88 at level 5: text: . + item-89 at level 5: text: bancrofti + item-90 at level 5: text: parasite, and (4) including only districts with + item-91 at level 5: text: Anopheles + item-92 at level 5: text: as the primary vector. The sensi ... ot have been truly LF-endemic [43,44]. + item-93 at level 2: section_header: Results + item-94 at level 3: text: The overall pre-TAS pass rate fo ... ts had baseline prevalences below 20%. + item-95 at level 3: picture + item-95 at level 4: caption: Fig 1 Number of pre-TAS by country. item-96 at level 3: picture - item-96 at level 4: caption: Fig 4 Adjusted risk ratios for pre-TAS failure with 95% Confidence Interval from log-binomial model. + item-96 at level 4: caption: Fig 2 District-level baseline prevalence by country. item-97 at level 3: inline: group group - item-98 at level 4: text: Sensitivity analyses were conduc ... cts in Africa, (3) only districts with - item-99 at level 4: text: W - item-100 at level 4: text: . - item-101 at level 4: text: bancrofti - item-102 at level 4: text: , and (4) only districts with - item-103 at level 4: text: Anopheles - item-104 at level 4: text: as primary vector. The results o ... hough the estimate was unstable in the - item-105 at level 4: text: W - item-106 at level 4: text: . - item-107 at level 4: text: bancrofti - item-108 at level 4: text: -only and - item-109 at level 4: text: Anopheles - item-110 at level 4: text: -only models (models 3 and 4 res ... gnified by large confidence intervals. - item-111 at level 3: table with [11x6] - item-111 at level 4: caption: Table 2 Adjusted risk ratios for pre-TAS failure from log-binomial model sensitivity analysis. - item-112 at level 3: text: Overall 74 districts in the data ... or 51% of all the failures (38 of 74). - item-113 at level 3: picture - item-113 at level 4: caption: Fig 5 Analysis of failures by model combinations. - item-114 at level 2: section_header: Discussion - item-115 at level 3: inline: group group - item-116 at level 4: text: This paper reports for the first ... similar to what was found in Goldberg - item-117 at level 4: text: et al - item-118 at level 4: text: ., which explored ecological and ... ctors associated with TAS failure [7]. - item-119 at level 3: text: Though diagnostic test used was ... FTS was more sensitive than ICT [45]. - item-120 at level 3: inline: group group - item-121 at level 4: text: Elevation was the only environme ... ous studies [8,31], including Goldberg - item-122 at level 4: text: et al - item-123 at level 4: text: . [7], who used a cutoff of 200 ... ich impact vector chances of survival. - item-124 at level 3: inline: group group - item-125 at level 4: text: The small number of failures ove ... ied in the bivariate analyses, such as - item-126 at level 4: text: Culex - item-127 at level 4: text: vector, higher population densit ... ecisions. Other models have shown that - item-128 at level 4: text: Culex - item-129 at level 4: text: as the predominant vector in a district, compared to - item-130 at level 4: text: Anopheles - item-131 at level 4: text: , results in more intense interv ... search has shown the opposite [15,16]. + item-98 at level 4: text: Fig 3 shows the unadjusted analy ... FTS diagnostic test, primary vector of + item-99 at level 4: text: Culex + item-100 at level 4: text: , treatment with DEC-ALB, higher ... overage, and sufficient rounds of MDA. + item-101 at level 3: picture + item-101 at level 4: caption: Fig 3 Percent pre-TAS failure by each characteristic (unadjusted). + item-102 at level 3: text: The final log-binomial model inc ... igh baseline and diagnostic test used. + item-103 at level 3: text: Fig 4 shows the risk ratio resul ... of failing pre-TAS (95% CI 1.95–4.83). + item-104 at level 3: picture + item-104 at level 4: caption: Fig 4 Adjusted risk ratios for pre-TAS failure with 95% Confidence Interval from log-binomial model. + item-105 at level 3: inline: group group + item-106 at level 4: text: Sensitivity analyses were conduc ... cts in Africa, (3) only districts with + item-107 at level 4: text: W + item-108 at level 4: text: . + item-109 at level 4: text: bancrofti + item-110 at level 4: text: , and (4) only districts with + item-111 at level 4: text: Anopheles + item-112 at level 4: text: as primary vector. The results o ... hough the estimate was unstable in the + item-113 at level 4: text: W + item-114 at level 4: text: . + item-115 at level 4: text: bancrofti + item-116 at level 4: text: -only and + item-117 at level 4: text: Anopheles + item-118 at level 4: text: -only models (models 3 and 4 res ... gnified by large confidence intervals. + item-119 at level 3: table with [11x6] + item-119 at level 4: caption: Table 2 Adjusted risk ratios for pre-TAS failure from log-binomial model sensitivity analysis. + item-120 at level 3: text: Overall 74 districts in the data ... or 51% of all the failures (38 of 74). + item-121 at level 3: picture + item-121 at level 4: caption: Fig 5 Analysis of failures by model combinations. + item-122 at level 2: section_header: Discussion + item-123 at level 3: inline: group group + item-124 at level 4: text: This paper reports for the first ... similar to what was found in Goldberg + item-125 at level 4: text: et al + item-126 at level 4: text: ., which explored ecological and ... ctors associated with TAS failure [7]. + item-127 at level 3: text: Though diagnostic test used was ... FTS was more sensitive than ICT [45]. + item-128 at level 3: inline: group group + item-129 at level 4: text: Elevation was the only environme ... ous studies [8,31], including Goldberg + item-130 at level 4: text: et al + item-131 at level 4: text: . [7], who used a cutoff of 200 ... ich impact vector chances of survival. item-132 at level 3: inline: group group - item-133 at level 4: text: All other variables included in ... -TAS failure in our analysis. Goldberg - item-134 at level 4: text: et al - item-135 at level 4: text: . found - item-136 at level 4: text: Brugia - item-137 at level 4: text: spp. to be significantly associa ... to the small number of districts with - item-138 at level 4: text: Brugia - item-139 at level 4: text: spp. in our dataset (6%) compared to 46% in the Goldberg - item-140 at level 4: text: et al - item-141 at level 4: text: . article [7]. MDA coverage leve ... are not necessary to lower prevalence. - item-142 at level 3: text: Limitations to this study includ ... reducing LF prevalence [41,48,51–53]. - item-143 at level 3: text: Fourteen districts were excluded ... ta to extreme outliners in a district. - item-144 at level 3: text: As this analysis used data acros ... of individuals included in the survey. - item-145 at level 3: text: This paper provides evidence fro ... th high baseline and/or low elevation. - item-146 at level 2: section_header: Acknowledgments - item-147 at level 3: text: The authors would like to thank ... e surveys financially and technically. - item-148 at level 2: section_header: References - item-149 at level 3: list: group list - item-150 at level 4: list_item: World Health Organization. Lymph ... trategic plan 2010–2020. Geneva; 2010. - item-151 at level 4: list_item: World Health Organization. Valid ... a public health problem. Geneva; 2017. - item-152 at level 4: list_item: World Health Organization. Globa ... Wkly Epidemiol Rec. 2019;94: 457–472. - item-153 at level 4: list_item: World Health Organization. Globa ... ass drug administration. Geneva; 2011. - item-154 at level 4: list_item: World Health Organization. Stren ... Disease-specific Indicators. 2016; 42. - item-155 at level 4: list_item: KyelemD, BiswasG, BockarieMJ, Br ... Trop Med Hyg. 2008;79: 480–4. 18840733 - item-156 at level 4: list_item: GoldbergEM, KingJD, MupfasoniD, ... . 2019; 10.4269/ajtmh.18-0721 31115301 - item-157 at level 4: list_item: CanoJ, RebolloMP, GoldingN, Pull ... : 1–19. 10.1186/1756-3305-7-1 24411014 - item-158 at level 4: list_item: CGIAR-CSI. CGIAR-CSI SRTM 90m DE ... Available: http://srtm.csi.cgiar.org/ - item-159 at level 4: list_item: USGS NASA. Vegetation indices 16 ... /lpdaac.usgs.gov/products/myd13a1v006/ - item-160 at level 4: list_item: FunkC, PetersonP, LandsfeldM, Pe ... 2015;2 10.1038/sdata.2015.66 26646728 - item-161 at level 4: list_item: LloydCT, SorichettaA, TatemAJ. H ... : 170001 10.1038/sdata.2017.1 28140386 - item-162 at level 4: list_item: ElvidgeCD, BaughKE, ZhizhinM, Hs ... Network; 2013;35: 62 10.7125/apan.35.7 - item-163 at level 4: list_item: JambulingamP, SubramanianS, De V ... 18. 10.1186/s13071-015-1291-6 26728523 - item-164 at level 4: list_item: MichaelE, Malecela-LazaroMN, Sim ... 10.1016/S1473-3099(04)00973-9 15050941 - item-165 at level 4: list_item: StolkWA, SwaminathanS, van Oortm ... ;188: 1371–81. 10.1086/378354 14593597 - item-166 at level 4: list_item: GradyCA, De RocharsMB, DirenyAN, ... 8–610. 10.3201/eid1304.061063 17553278 - item-167 at level 4: list_item: EvansD, McFarlandD, AdamaniW, Ei ... 0.1179/2047773211Y.0000000010 22325813 - item-168 at level 4: list_item: RichardsFO, EigegeA, MiriES, Kal ... 10.1371/journal.pntd.0001346 22022627 - item-169 at level 4: list_item: BiritwumNK, YikpoteyP, MarfoBK, ... 90–695. 10.1093/trstmh/trx007 28938053 - item-170 at level 4: list_item: MoragaP, CanoJ, BaggaleyRF, Gyap ... 16. 10.1186/s13071-014-0608-1 25561160 - item-171 at level 4: list_item: IrvineMA, NjengaSM, GunawardenaS ... 18–124. 10.1093/trstmh/trv096 26822604 - item-172 at level 4: list_item: OttesenEA. Efficacy of diethylca ... iae in humans. Rev Infect Dis. 1985;7. - item-173 at level 4: list_item: GambhirM, BockarieM, TischD, Kaz ... 2010;8 10.1186/1741-7007-8-22 20236528 - item-174 at level 4: list_item: World Health Organization. Globa ... cal entomology handbook. Geneva; 2013. - item-175 at level 4: list_item: SlaterH, MichaelE. Predicting th ... 10.1371/journal.pone.0032202 22359670 - item-176 at level 4: list_item: SlaterH, MichaelE. Mapping, Baye ... 10.1371/journal.pone.0071574 23951194 - item-177 at level 4: list_item: SabesanS, RajuKHK, SubramanianS, ... 57–665. 10.1089/vbz.2012.1238 23808973 - item-178 at level 4: list_item: StantonMC, MolyneuxDH, KyelemD, ... : 159–173. 10.4081/gh.2013.63 24258892 - item-179 at level 4: list_item: ManhenjeI, Teresa Galán-Puchades ... : 391–398. 10.4081/gh.2013.96 23733300 - item-180 at level 4: list_item: NgwiraBM, TambalaP, Perez aM, Bo ... ;6: 12 10.1186/1475-2883-6-12 18047646 - item-181 at level 4: list_item: SimonsenPE, MwakitaluME. Urban l ... 44. 10.1007/s00436-012-3226-x 23239094 - item-182 at level 4: list_item: ProvilleJ, Zavala-AraizaD, Wagne ... 10.1371/journal.pone.0174610 28346500 - item-183 at level 4: list_item: EndeshawT, TayeA, TadesseZ, Kata ... 10.1080/20477724.2015.1103501 26878935 - item-184 at level 4: list_item: RichardsFO, EigegeA, PamD, KalA, ... 4: 3–5. 10.1186/1475-2883-4-3 15916708 - item-185 at level 4: list_item: KyelemD, SanouS, BoatinB a., Med ... 8. 10.1179/000349803225002462 14754495 - item-186 at level 4: list_item: WeilGJ, LammiePJ, RichardsFO, Eb ... –816. 10.1093/infdis/164.4.814 1894943 - item-187 at level 4: list_item: KumarA, SachanP. Measuring impac ... rop Biomed. 2014;31: 225–229. 25134891 - item-188 at level 4: list_item: NjengaSM, MwandawiroCS, WamaeCN, ... 4: 1–9. 10.1186/1756-3305-4-1 21205315 - item-189 at level 4: list_item: BoydA, WonKY, McClintockSK, Dono ... 10.1371/journal.pntd.0000640 20351776 - item-190 at level 4: list_item: IrvineMA, ReimerLJ, NjengaSM, Gu ... 19. 10.1186/s13071-014-0608-1 25561160 - item-191 at level 4: list_item: IrvineMA, StolkWA, SmithME, Subr ... 10.1016/S1473-3099(16)30467-4 28012943 - item-192 at level 4: list_item: PionSD, MontavonC, ChesnaisCB, K ... 7–1423. 10.4269/ajtmh.16-0547 27729568 - item-193 at level 4: list_item: WanjiS, EsumME, NjouendouAJ, Mbe ... 10.1371/journal.pntd.0007192 30849120 - item-194 at level 4: list_item: ChesnaisCB, Awaca-UvonNP, BolayF ... 10.1371/journal.pntd.0005703 28892473 - item-195 at level 4: list_item: SilumbweA, ZuluJM, HalwindiH, Ja ... 15. 10.1186/s12889-017-4414-5 28532397 - item-196 at level 4: list_item: AdamsAM, VuckovicM, BirchE, Bran ... ;3 10.3390/tropicalmed3040122 30469342 - item-197 at level 4: list_item: RaoRU, SamarasekeraSD, Nagodavit ... 10.1371/journal.pntd.0006066 29084213 - item-198 at level 4: list_item: XuZ, GravesPM, LauCL, ClementsA, ... 10.1016/j.epidem.2018.12.003 30611745 - item-199 at level 4: list_item: IdCM, TetteviEJ, MechanF, IdunB, ... Ghana. PLoS Negl Trop Dis. 2019; 1–17. - item-200 at level 4: list_item: EigegeA, KalA, MiriE, SallauA, U ... 10.1371/journal.pntd.0002508 24205421 - item-201 at level 4: list_item: Van den BergH, Kelly-HopeLA, Lin ... 10.1016/S1473-3099(12)70148-2 23084831 - item-202 at level 4: list_item: WebberR. Eradication of Wucherer ... ol. Trans R Soc Trop Med Hyg. 1979;73. - item-203 at level 1: caption: Table 1 Categorization of potential factors influencing pre-TAS results. - item-204 at level 1: caption: Fig 1 Number of pre-TAS by country. - item-205 at level 1: caption: Fig 2 District-level baseline prevalence by country. - item-206 at level 1: caption: Fig 3 Percent pre-TAS failure by each characteristic (unadjusted). - item-207 at level 1: caption: Fig 4 Adjusted risk ratios for p ... ence Interval from log-binomial model. - item-208 at level 1: caption: Table 2 Adjusted risk ratios for ... g-binomial model sensitivity analysis. - item-209 at level 1: caption: Fig 5 Analysis of failures by model combinations. \ No newline at end of file + item-133 at level 4: text: The small number of failures ove ... ied in the bivariate analyses, such as + item-134 at level 4: text: Culex + item-135 at level 4: text: vector, higher population densit ... ecisions. Other models have shown that + item-136 at level 4: text: Culex + item-137 at level 4: text: as the predominant vector in a district, compared to + item-138 at level 4: text: Anopheles + item-139 at level 4: text: , results in more intense interv ... search has shown the opposite [15,16]. + item-140 at level 3: inline: group group + item-141 at level 4: text: All other variables included in ... -TAS failure in our analysis. Goldberg + item-142 at level 4: text: et al + item-143 at level 4: text: . found + item-144 at level 4: text: Brugia + item-145 at level 4: text: spp. to be significantly associa ... to the small number of districts with + item-146 at level 4: text: Brugia + item-147 at level 4: text: spp. in our dataset (6%) compared to 46% in the Goldberg + item-148 at level 4: text: et al + item-149 at level 4: text: . article [7]. MDA coverage leve ... are not necessary to lower prevalence. + item-150 at level 3: text: Limitations to this study includ ... reducing LF prevalence [41,48,51–53]. + item-151 at level 3: text: Fourteen districts were excluded ... ta to extreme outliners in a district. + item-152 at level 3: text: As this analysis used data acros ... of individuals included in the survey. + item-153 at level 3: text: This paper provides evidence fro ... th high baseline and/or low elevation. + item-154 at level 2: section_header: Acknowledgments + item-155 at level 3: text: The authors would like to thank ... e surveys financially and technically. + item-156 at level 2: section_header: References + item-157 at level 3: list: group list + item-158 at level 4: list_item: World Health Organization. Lymph ... trategic plan 2010–2020. Geneva; 2010. + item-159 at level 4: list_item: World Health Organization. Valid ... a public health problem. Geneva; 2017. + item-160 at level 4: list_item: World Health Organization. Globa ... Wkly Epidemiol Rec. 2019;94: 457–472. + item-161 at level 4: list_item: World Health Organization. Globa ... ass drug administration. Geneva; 2011. + item-162 at level 4: list_item: World Health Organization. Stren ... Disease-specific Indicators. 2016; 42. + item-163 at level 4: list_item: KyelemD, BiswasG, BockarieMJ, Br ... Trop Med Hyg. 2008;79: 480–4. 18840733 + item-164 at level 4: list_item: GoldbergEM, KingJD, MupfasoniD, ... . 2019; 10.4269/ajtmh.18-0721 31115301 + item-165 at level 4: list_item: CanoJ, RebolloMP, GoldingN, Pull ... : 1–19. 10.1186/1756-3305-7-1 24411014 + item-166 at level 4: list_item: CGIAR-CSI. CGIAR-CSI SRTM 90m DE ... Available: http://srtm.csi.cgiar.org/ + item-167 at level 4: list_item: USGS NASA. Vegetation indices 16 ... /lpdaac.usgs.gov/products/myd13a1v006/ + item-168 at level 4: list_item: FunkC, PetersonP, LandsfeldM, Pe ... 2015;2 10.1038/sdata.2015.66 26646728 + item-169 at level 4: list_item: LloydCT, SorichettaA, TatemAJ. H ... : 170001 10.1038/sdata.2017.1 28140386 + item-170 at level 4: list_item: ElvidgeCD, BaughKE, ZhizhinM, Hs ... Network; 2013;35: 62 10.7125/apan.35.7 + item-171 at level 4: list_item: JambulingamP, SubramanianS, De V ... 18. 10.1186/s13071-015-1291-6 26728523 + item-172 at level 4: list_item: MichaelE, Malecela-LazaroMN, Sim ... 10.1016/S1473-3099(04)00973-9 15050941 + item-173 at level 4: list_item: StolkWA, SwaminathanS, van Oortm ... ;188: 1371–81. 10.1086/378354 14593597 + item-174 at level 4: list_item: GradyCA, De RocharsMB, DirenyAN, ... 8–610. 10.3201/eid1304.061063 17553278 + item-175 at level 4: list_item: EvansD, McFarlandD, AdamaniW, Ei ... 0.1179/2047773211Y.0000000010 22325813 + item-176 at level 4: list_item: RichardsFO, EigegeA, MiriES, Kal ... 10.1371/journal.pntd.0001346 22022627 + item-177 at level 4: list_item: BiritwumNK, YikpoteyP, MarfoBK, ... 90–695. 10.1093/trstmh/trx007 28938053 + item-178 at level 4: list_item: MoragaP, CanoJ, BaggaleyRF, Gyap ... 16. 10.1186/s13071-014-0608-1 25561160 + item-179 at level 4: list_item: IrvineMA, NjengaSM, GunawardenaS ... 18–124. 10.1093/trstmh/trv096 26822604 + item-180 at level 4: list_item: OttesenEA. Efficacy of diethylca ... iae in humans. Rev Infect Dis. 1985;7. + item-181 at level 4: list_item: GambhirM, BockarieM, TischD, Kaz ... 2010;8 10.1186/1741-7007-8-22 20236528 + item-182 at level 4: list_item: World Health Organization. Globa ... cal entomology handbook. Geneva; 2013. + item-183 at level 4: list_item: SlaterH, MichaelE. Predicting th ... 10.1371/journal.pone.0032202 22359670 + item-184 at level 4: list_item: SlaterH, MichaelE. Mapping, Baye ... 10.1371/journal.pone.0071574 23951194 + item-185 at level 4: list_item: SabesanS, RajuKHK, SubramanianS, ... 57–665. 10.1089/vbz.2012.1238 23808973 + item-186 at level 4: list_item: StantonMC, MolyneuxDH, KyelemD, ... : 159–173. 10.4081/gh.2013.63 24258892 + item-187 at level 4: list_item: ManhenjeI, Teresa Galán-Puchades ... : 391–398. 10.4081/gh.2013.96 23733300 + item-188 at level 4: list_item: NgwiraBM, TambalaP, Perez aM, Bo ... ;6: 12 10.1186/1475-2883-6-12 18047646 + item-189 at level 4: list_item: SimonsenPE, MwakitaluME. Urban l ... 44. 10.1007/s00436-012-3226-x 23239094 + item-190 at level 4: list_item: ProvilleJ, Zavala-AraizaD, Wagne ... 10.1371/journal.pone.0174610 28346500 + item-191 at level 4: list_item: EndeshawT, TayeA, TadesseZ, Kata ... 10.1080/20477724.2015.1103501 26878935 + item-192 at level 4: list_item: RichardsFO, EigegeA, PamD, KalA, ... 4: 3–5. 10.1186/1475-2883-4-3 15916708 + item-193 at level 4: list_item: KyelemD, SanouS, BoatinB a., Med ... 8. 10.1179/000349803225002462 14754495 + item-194 at level 4: list_item: WeilGJ, LammiePJ, RichardsFO, Eb ... –816. 10.1093/infdis/164.4.814 1894943 + item-195 at level 4: list_item: KumarA, SachanP. Measuring impac ... rop Biomed. 2014;31: 225–229. 25134891 + item-196 at level 4: list_item: NjengaSM, MwandawiroCS, WamaeCN, ... 4: 1–9. 10.1186/1756-3305-4-1 21205315 + item-197 at level 4: list_item: BoydA, WonKY, McClintockSK, Dono ... 10.1371/journal.pntd.0000640 20351776 + item-198 at level 4: list_item: IrvineMA, ReimerLJ, NjengaSM, Gu ... 19. 10.1186/s13071-014-0608-1 25561160 + item-199 at level 4: list_item: IrvineMA, StolkWA, SmithME, Subr ... 10.1016/S1473-3099(16)30467-4 28012943 + item-200 at level 4: list_item: PionSD, MontavonC, ChesnaisCB, K ... 7–1423. 10.4269/ajtmh.16-0547 27729568 + item-201 at level 4: list_item: WanjiS, EsumME, NjouendouAJ, Mbe ... 10.1371/journal.pntd.0007192 30849120 + item-202 at level 4: list_item: ChesnaisCB, Awaca-UvonNP, BolayF ... 10.1371/journal.pntd.0005703 28892473 + item-203 at level 4: list_item: SilumbweA, ZuluJM, HalwindiH, Ja ... 15. 10.1186/s12889-017-4414-5 28532397 + item-204 at level 4: list_item: AdamsAM, VuckovicM, BirchE, Bran ... ;3 10.3390/tropicalmed3040122 30469342 + item-205 at level 4: list_item: RaoRU, SamarasekeraSD, Nagodavit ... 10.1371/journal.pntd.0006066 29084213 + item-206 at level 4: list_item: XuZ, GravesPM, LauCL, ClementsA, ... 10.1016/j.epidem.2018.12.003 30611745 + item-207 at level 4: list_item: IdCM, TetteviEJ, MechanF, IdunB, ... Ghana. PLoS Negl Trop Dis. 2019; 1–17. + item-208 at level 4: list_item: EigegeA, KalA, MiriE, SallauA, U ... 10.1371/journal.pntd.0002508 24205421 + item-209 at level 4: list_item: Van den BergH, Kelly-HopeLA, Lin ... 10.1016/S1473-3099(12)70148-2 23084831 + item-210 at level 4: list_item: WebberR. Eradication of Wucherer ... ol. Trans R Soc Trop Med Hyg. 1979;73. + item-211 at level 1: caption: Table 1 Categorization of potential factors influencing pre-TAS results. + item-212 at level 1: caption: Fig 1 Number of pre-TAS by country. + item-213 at level 1: caption: Fig 2 District-level baseline prevalence by country. + item-214 at level 1: caption: Fig 3 Percent pre-TAS failure by each characteristic (unadjusted). + item-215 at level 1: caption: Fig 4 Adjusted risk ratios for p ... ence Interval from log-binomial model. + item-216 at level 1: caption: Table 2 Adjusted risk ratios for ... g-binomial model sensitivity analysis. + item-217 at level 1: caption: Fig 5 Analysis of failures by model combinations. \ No newline at end of file diff --git a/tests/data/jats/groundtruth/pntd.0008301.nxml.json b/tests/data/jats/groundtruth/pntd.0008301.nxml.json index 0221913779..f6d188c379 100644 --- a/tests/data/jats/groundtruth/pntd.0008301.nxml.json +++ b/tests/data/jats/groundtruth/pntd.0008301.nxml.json @@ -24,22 +24,22 @@ "$ref": "#/texts/20" }, { - "$ref": "#/texts/80" + "$ref": "#/texts/84" }, { - "$ref": "#/texts/81" + "$ref": "#/texts/85" }, { - "$ref": "#/texts/85" + "$ref": "#/texts/89" }, { - "$ref": "#/texts/88" + "$ref": "#/texts/92" }, { - "$ref": "#/texts/102" + "$ref": "#/texts/106" }, { - "$ref": "#/texts/104" + "$ref": "#/texts/108" } ], "content_layer": "body", @@ -90,17 +90,28 @@ { "self_ref": "#/groups/2", "parent": { - "$ref": "#/texts/23" + "$ref": "#/tables/0" }, "children": [ { - "$ref": "#/texts/25" - }, + "$ref": "#/groups/3" + } + ], + "content_layer": "body", + "name": "rich_cell_group_1_3_6", + "label": "unspecified" + }, + { + "self_ref": "#/groups/3", + "parent": { + "$ref": "#/groups/2" + }, + "children": [ { - "$ref": "#/texts/26" + "$ref": "#/texts/21" }, { - "$ref": "#/texts/27" + "$ref": "#/texts/22" } ], "content_layer": "body", @@ -108,23 +119,62 @@ "label": "inline" }, { - "self_ref": "#/groups/3", + "self_ref": "#/groups/4", "parent": { - "$ref": "#/texts/30" + "$ref": "#/tables/0" }, "children": [ { - "$ref": "#/texts/31" - }, + "$ref": "#/groups/5" + } + ], + "content_layer": "body", + "name": "rich_cell_group_1_3_9", + "label": "unspecified" + }, + { + "self_ref": "#/groups/5", + "parent": { + "$ref": "#/groups/4" + }, + "children": [ { - "$ref": "#/texts/32" + "$ref": "#/texts/23" }, { - "$ref": "#/texts/33" + "$ref": "#/texts/24" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/6", + "parent": { + "$ref": "#/texts/27" + }, + "children": [ + { + "$ref": "#/texts/29" }, { - "$ref": "#/texts/34" + "$ref": "#/texts/30" }, + { + "$ref": "#/texts/31" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/7", + "parent": { + "$ref": "#/texts/34" + }, + "children": [ { "$ref": "#/texts/35" }, @@ -181,6 +231,18 @@ }, { "$ref": "#/texts/53" + }, + { + "$ref": "#/texts/54" + }, + { + "$ref": "#/texts/55" + }, + { + "$ref": "#/texts/56" + }, + { + "$ref": "#/texts/57" } ], "content_layer": "body", @@ -188,25 +250,25 @@ "label": "inline" }, { - "self_ref": "#/groups/4", + "self_ref": "#/groups/8", "parent": { - "$ref": "#/texts/54" + "$ref": "#/texts/58" }, "children": [ { - "$ref": "#/texts/56" + "$ref": "#/texts/60" }, { - "$ref": "#/texts/57" + "$ref": "#/texts/61" }, { - "$ref": "#/texts/58" + "$ref": "#/texts/62" }, { - "$ref": "#/texts/59" + "$ref": "#/texts/63" }, { - "$ref": "#/texts/60" + "$ref": "#/texts/64" } ], "content_layer": "body", @@ -214,31 +276,31 @@ "label": "inline" }, { - "self_ref": "#/groups/5", + "self_ref": "#/groups/9", "parent": { - "$ref": "#/texts/69" + "$ref": "#/texts/73" }, "children": [ { - "$ref": "#/texts/71" + "$ref": "#/texts/75" }, { - "$ref": "#/texts/72" + "$ref": "#/texts/76" }, { - "$ref": "#/texts/73" + "$ref": "#/texts/77" }, { - "$ref": "#/texts/74" + "$ref": "#/texts/78" }, { - "$ref": "#/texts/75" + "$ref": "#/texts/79" }, { - "$ref": "#/texts/76" + "$ref": "#/texts/80" }, { - "$ref": "#/texts/77" + "$ref": "#/texts/81" } ], "content_layer": "body", @@ -246,19 +308,19 @@ "label": "inline" }, { - "self_ref": "#/groups/6", + "self_ref": "#/groups/10", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [ { - "$ref": "#/texts/82" + "$ref": "#/texts/86" }, { - "$ref": "#/texts/83" + "$ref": "#/texts/87" }, { - "$ref": "#/texts/84" + "$ref": "#/texts/88" } ], "content_layer": "body", @@ -266,23 +328,11 @@ "label": "inline" }, { - "self_ref": "#/groups/7", + "self_ref": "#/groups/11", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [ - { - "$ref": "#/texts/89" - }, - { - "$ref": "#/texts/90" - }, - { - "$ref": "#/texts/91" - }, - { - "$ref": "#/texts/92" - }, { "$ref": "#/texts/93" }, @@ -309,6 +359,18 @@ }, { "$ref": "#/texts/101" + }, + { + "$ref": "#/texts/102" + }, + { + "$ref": "#/texts/103" + }, + { + "$ref": "#/texts/104" + }, + { + "$ref": "#/texts/105" } ], "content_layer": "body", @@ -316,19 +378,19 @@ "label": "inline" }, { - "self_ref": "#/groups/8", + "self_ref": "#/groups/12", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [ { - "$ref": "#/texts/106" + "$ref": "#/texts/110" }, { - "$ref": "#/texts/107" + "$ref": "#/texts/111" }, { - "$ref": "#/texts/108" + "$ref": "#/texts/112" } ], "content_layer": "body", @@ -336,19 +398,19 @@ "label": "inline" }, { - "self_ref": "#/groups/9", + "self_ref": "#/groups/13", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [ { - "$ref": "#/texts/110" + "$ref": "#/texts/114" }, { - "$ref": "#/texts/111" + "$ref": "#/texts/115" }, { - "$ref": "#/texts/112" + "$ref": "#/texts/116" } ], "content_layer": "body", @@ -356,31 +418,31 @@ "label": "inline" }, { - "self_ref": "#/groups/10", + "self_ref": "#/groups/14", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [ { - "$ref": "#/texts/113" + "$ref": "#/texts/117" }, { - "$ref": "#/texts/114" + "$ref": "#/texts/118" }, { - "$ref": "#/texts/115" + "$ref": "#/texts/119" }, { - "$ref": "#/texts/116" + "$ref": "#/texts/120" }, { - "$ref": "#/texts/117" + "$ref": "#/texts/121" }, { - "$ref": "#/texts/118" + "$ref": "#/texts/122" }, { - "$ref": "#/texts/119" + "$ref": "#/texts/123" } ], "content_layer": "body", @@ -388,37 +450,37 @@ "label": "inline" }, { - "self_ref": "#/groups/11", + "self_ref": "#/groups/15", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [ { - "$ref": "#/texts/120" + "$ref": "#/texts/124" }, { - "$ref": "#/texts/121" + "$ref": "#/texts/125" }, { - "$ref": "#/texts/122" + "$ref": "#/texts/126" }, { - "$ref": "#/texts/123" + "$ref": "#/texts/127" }, { - "$ref": "#/texts/124" + "$ref": "#/texts/128" }, { - "$ref": "#/texts/125" + "$ref": "#/texts/129" }, { - "$ref": "#/texts/126" + "$ref": "#/texts/130" }, { - "$ref": "#/texts/127" + "$ref": "#/texts/131" }, { - "$ref": "#/texts/128" + "$ref": "#/texts/132" } ], "content_layer": "body", @@ -426,23 +488,11 @@ "label": "inline" }, { - "self_ref": "#/groups/12", + "self_ref": "#/groups/16", "parent": { - "$ref": "#/texts/135" + "$ref": "#/texts/139" }, "children": [ - { - "$ref": "#/texts/136" - }, - { - "$ref": "#/texts/137" - }, - { - "$ref": "#/texts/138" - }, - { - "$ref": "#/texts/139" - }, { "$ref": "#/texts/140" }, @@ -589,6 +639,18 @@ }, { "$ref": "#/texts/188" + }, + { + "$ref": "#/texts/189" + }, + { + "$ref": "#/texts/190" + }, + { + "$ref": "#/texts/191" + }, + { + "$ref": "#/texts/192" } ], "content_layer": "body", @@ -622,16 +684,16 @@ "$ref": "#/texts/17" }, { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, { - "$ref": "#/texts/133" + "$ref": "#/texts/137" }, { - "$ref": "#/texts/135" + "$ref": "#/texts/139" } ], "content_layer": "body", @@ -889,16 +951,16 @@ "$ref": "#/tables/0" }, { - "$ref": "#/texts/21" + "$ref": "#/texts/25" }, { - "$ref": "#/texts/23" + "$ref": "#/texts/27" }, { - "$ref": "#/texts/67" + "$ref": "#/texts/71" }, { - "$ref": "#/texts/69" + "$ref": "#/texts/73" } ], "content_layer": "body", @@ -946,12 +1008,74 @@ }, { "self_ref": "#/texts/21", + "parent": { + "$ref": "#/groups/3" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Area measured in km", + "text": "Area measured in km" + }, + { + "self_ref": "#/texts/22", + "parent": { + "$ref": "#/groups/3" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/23", + "parent": { + "$ref": "#/groups/5" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Number of people per km", + "text": "Number of people per km" + }, + { + "self_ref": "#/texts/24", + "parent": { + "$ref": "#/groups/5" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/25", "parent": { "$ref": "#/texts/17" }, "children": [ { - "$ref": "#/texts/22" + "$ref": "#/texts/26" } ], "content_layer": "body", @@ -962,9 +1086,9 @@ "level": 2 }, { - "self_ref": "#/texts/22", + "self_ref": "#/texts/26", "parent": { - "$ref": "#/texts/21" + "$ref": "#/texts/25" }, "children": [], "content_layer": "body", @@ -974,31 +1098,31 @@ "text": "Information on baseline prevalence, MDA coverage, the number of MDA rounds, and pre-TAS information (month and year of survey, district, site name, and outcome) was gathered through regular reporting for the USAID-funded NTD programs (ENVISION, END in Africa, and END in Asia). These data were augmented by other reporting data such as the country’s dossier data annexes, the WHO Preventive Chemotherapy and Transmission Control Databank, and WHO reporting forms. Data were then reviewed by country experts, including the Ministry of Health program staff and implementing program staff, and updated as necessary. Data on vectors were also obtained from country experts. The district geographic boundaries were matched to geospatial shapefiles from the ENVISION project geospatial data repository, while other geospatial data were obtained through publicly available sources (Table 1)." }, { - "self_ref": "#/texts/23", + "self_ref": "#/texts/27", "parent": { "$ref": "#/texts/17" }, "children": [ { - "$ref": "#/texts/24" + "$ref": "#/texts/28" }, { - "$ref": "#/groups/2" + "$ref": "#/groups/6" }, { - "$ref": "#/texts/28" + "$ref": "#/texts/32" }, { - "$ref": "#/texts/30" + "$ref": "#/texts/34" }, { - "$ref": "#/texts/54" + "$ref": "#/texts/58" }, { - "$ref": "#/texts/62" + "$ref": "#/texts/66" }, { - "$ref": "#/texts/65" + "$ref": "#/texts/69" } ], "content_layer": "body", @@ -1009,9 +1133,9 @@ "level": 2 }, { - "self_ref": "#/texts/24", + "self_ref": "#/texts/28", "parent": { - "$ref": "#/texts/23" + "$ref": "#/texts/27" }, "children": [], "content_layer": "body", @@ -1021,9 +1145,9 @@ "text": "The outcome of interest for this analysis was whether a district passed or failed the pre-TAS. Failure was defined as any district that had at least one sentinel or spot-check site with a prevalence higher than or equal to 1% Mf or 2% Ag [4]." }, { - "self_ref": "#/texts/25", + "self_ref": "#/texts/29", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/6" }, "children": [], "content_layer": "body", @@ -1033,9 +1157,9 @@ "text": "Potential covariates were derived from the available data for each factor in the domain groups listed in Table 1. New dichotomous variables were created for all variables that had multiple categories or were continuous for ease of interpretation in models and use in program decision-making. Cut-points for continuous variables were derived from either" }, { - "self_ref": "#/texts/26", + "self_ref": "#/texts/30", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/6" }, "children": [], "content_layer": "body", @@ -1052,9 +1176,9 @@ } }, { - "self_ref": "#/texts/27", + "self_ref": "#/texts/31", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/6" }, "children": [], "content_layer": "body", @@ -1064,13 +1188,13 @@ "text": "knowledge or through exploratory analysis considering the mean or median value of the dataset, looking to create two groups of similar size with logical cut-points (e.g. rounding numbers to whole numbers). All the variables derived from publicly available global spatial raster datasets were summarized to the district level in ArcGIS Pro using the “zonal statistics” tool. The final output used the continuous value measuring the mean pixel value for the district for all variables except geographic area. Categories for each variable were determined by selecting the mean or median dataset value or cut-off used in other relevant literature [7]. The following section describes the variables that were included in the final analysis and the final categorizations used." }, { - "self_ref": "#/texts/28", + "self_ref": "#/texts/32", "parent": { - "$ref": "#/texts/23" + "$ref": "#/texts/27" }, "children": [ { - "$ref": "#/texts/29" + "$ref": "#/texts/33" } ], "content_layer": "body", @@ -1081,9 +1205,9 @@ "level": 3 }, { - "self_ref": "#/texts/29", + "self_ref": "#/texts/33", "parent": { - "$ref": "#/texts/28" + "$ref": "#/texts/32" }, "children": [], "content_layer": "body", @@ -1093,13 +1217,13 @@ "text": "Baseline prevalence can be assumed as a proxy for local transmission conditions [14] and correlates with prevalence after MDA [14–20]. Baseline prevalence for each district was measured by either blood smears to measure Mf or rapid diagnostic tests to measure Ag. Other studies have modeled Mf and Ag prevalence separately, due to lack of a standardized correlation between the two, especially at pre-MDA levels [21,22]. However, because WHO mapping guidance states that MDA is required if either Mf or Ag is ≥1% and there were not enough data to model each separately, we combined baseline prevalence values regardless of diagnostic test used. We created two variables for use in the analysis (1) using the cut-off of <5% or ≥5% (dataset median value of 5%) and (2) using the cut-off of <10% or ≥10%." }, { - "self_ref": "#/texts/30", + "self_ref": "#/texts/34", "parent": { - "$ref": "#/texts/23" + "$ref": "#/texts/27" }, "children": [ { - "$ref": "#/groups/3" + "$ref": "#/groups/7" } ], "content_layer": "body", @@ -1110,9 +1234,9 @@ "level": 3 }, { - "self_ref": "#/texts/31", + "self_ref": "#/texts/35", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1122,9 +1246,9 @@ "text": "In terms of differences in transmission dynamics by agent, research has shown that" }, { - "self_ref": "#/texts/32", + "self_ref": "#/texts/36", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1141,9 +1265,9 @@ } }, { - "self_ref": "#/texts/33", + "self_ref": "#/texts/37", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1153,9 +1277,9 @@ "text": "spp. are more susceptible to the anti-filarial drug regimens than" }, { - "self_ref": "#/texts/34", + "self_ref": "#/texts/38", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1172,9 +1296,9 @@ } }, { - "self_ref": "#/texts/35", + "self_ref": "#/texts/39", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1184,9 +1308,9 @@ "text": "parasites [23]. Thus, we combined districts reporting" }, { - "self_ref": "#/texts/36", + "self_ref": "#/texts/40", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1203,9 +1327,9 @@ } }, { - "self_ref": "#/texts/37", + "self_ref": "#/texts/41", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1215,9 +1339,9 @@ "text": "." }, { - "self_ref": "#/texts/38", + "self_ref": "#/texts/42", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1234,9 +1358,9 @@ } }, { - "self_ref": "#/texts/39", + "self_ref": "#/texts/43", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1246,9 +1370,9 @@ "text": "and" }, { - "self_ref": "#/texts/40", + "self_ref": "#/texts/44", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1265,9 +1389,9 @@ } }, { - "self_ref": "#/texts/41", + "self_ref": "#/texts/45", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1277,9 +1401,9 @@ "text": "." }, { - "self_ref": "#/texts/42", + "self_ref": "#/texts/46", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1296,9 +1420,9 @@ } }, { - "self_ref": "#/texts/43", + "self_ref": "#/texts/47", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1308,9 +1432,9 @@ "text": "and compared them to areas with" }, { - "self_ref": "#/texts/44", + "self_ref": "#/texts/48", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1327,9 +1451,9 @@ } }, { - "self_ref": "#/texts/45", + "self_ref": "#/texts/49", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1339,9 +1463,9 @@ "text": "." }, { - "self_ref": "#/texts/46", + "self_ref": "#/texts/50", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1358,9 +1482,9 @@ } }, { - "self_ref": "#/texts/47", + "self_ref": "#/texts/51", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1370,9 +1494,9 @@ "text": "or mixed parasites. Two variables from other domains were identified in exploratory analyses to be highly colinear with the parasite, and thus we considered them in the same group of variables for the final regression models. These were variables delineating vectors (" }, { - "self_ref": "#/texts/48", + "self_ref": "#/texts/52", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1389,9 +1513,9 @@ } }, { - "self_ref": "#/texts/49", + "self_ref": "#/texts/53", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1401,9 +1525,9 @@ "text": "or" }, { - "self_ref": "#/texts/50", + "self_ref": "#/texts/54", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1420,9 +1544,9 @@ } }, { - "self_ref": "#/texts/51", + "self_ref": "#/texts/55", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1432,9 +1556,9 @@ "text": "compared to" }, { - "self_ref": "#/texts/52", + "self_ref": "#/texts/56", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1451,9 +1575,9 @@ } }, { - "self_ref": "#/texts/53", + "self_ref": "#/texts/57", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/7" }, "children": [], "content_layer": "body", @@ -1463,19 +1587,19 @@ "text": ") from the environmental domain and drug package [ivermectin-albendazole (IVM-ALB) compared to diethylcarbamazine-albendazole (DEC-ALB)] from the MDA domain." }, { - "self_ref": "#/texts/54", + "self_ref": "#/texts/58", "parent": { - "$ref": "#/texts/23" + "$ref": "#/texts/27" }, "children": [ { - "$ref": "#/texts/55" + "$ref": "#/texts/59" }, { - "$ref": "#/groups/4" + "$ref": "#/groups/8" }, { - "$ref": "#/texts/61" + "$ref": "#/texts/65" } ], "content_layer": "body", @@ -1486,9 +1610,9 @@ "level": 3 }, { - "self_ref": "#/texts/55", + "self_ref": "#/texts/59", "parent": { - "$ref": "#/texts/54" + "$ref": "#/texts/58" }, "children": [], "content_layer": "body", @@ -1498,9 +1622,9 @@ "text": "LF transmission intensity is influenced by differing vector transmission dynamics, including vector biting rates and competence, and the number of individuals with microfilaria [21,24,25]. Since vector data are not always available, previous studies have explored whether environmental variables associated with vector density, such as elevation, rainfall, and temperature, can be used to predict LF prevalence [8,21,26–31]. We included the district area and elevation in meters as geographic variables potentially associated with transmission intensity. In addition, within the climate factor, we included Enhanced Vegetation Index (EVI) and rainfall variables. EVI measures vegetation levels, or “greenness,” where a higher index value indicates a higher level of “greenness.”" }, { - "self_ref": "#/texts/56", + "self_ref": "#/texts/60", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/8" }, "children": [], "content_layer": "body", @@ -1510,9 +1634,9 @@ "text": "We included the socio-economic variable of population density, as it has been positively associated with LF prevalence in some studies [8,27,29], but no significant association has been found in others [30]. Population density could be correlated with vector, as in eastern African countries LF is mostly transmitted by" }, { - "self_ref": "#/texts/57", + "self_ref": "#/texts/61", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/8" }, "children": [], "content_layer": "body", @@ -1529,9 +1653,9 @@ } }, { - "self_ref": "#/texts/58", + "self_ref": "#/texts/62", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/8" }, "children": [], "content_layer": "body", @@ -1541,9 +1665,9 @@ "text": "in urban areas and by" }, { - "self_ref": "#/texts/59", + "self_ref": "#/texts/63", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/8" }, "children": [], "content_layer": "body", @@ -1560,9 +1684,9 @@ } }, { - "self_ref": "#/texts/60", + "self_ref": "#/texts/64", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/8" }, "children": [], "content_layer": "body", @@ -1572,9 +1696,9 @@ "text": "in rural areas [32]. Additionally, inclusion of the satellite imagery of nighttime lights data is another a proxy for socio-economic status [33]." }, { - "self_ref": "#/texts/61", + "self_ref": "#/texts/65", "parent": { - "$ref": "#/texts/54" + "$ref": "#/texts/58" }, "children": [], "content_layer": "body", @@ -1584,16 +1708,16 @@ "text": "Finally, all or parts of districts that are co-endemic with onchocerciasis may have received multiple rounds of MDA with ivermectin before LF MDA started, which may have lowered LF prevalence in an area [34–36]. Thus, we included a categorical variable to distinguish if districts were co-endemic with onchocerciasis." }, { - "self_ref": "#/texts/62", + "self_ref": "#/texts/66", "parent": { - "$ref": "#/texts/23" + "$ref": "#/texts/27" }, "children": [ { - "$ref": "#/texts/63" + "$ref": "#/texts/67" }, { - "$ref": "#/texts/64" + "$ref": "#/texts/68" } ], "content_layer": "body", @@ -1604,9 +1728,9 @@ "level": 3 }, { - "self_ref": "#/texts/63", + "self_ref": "#/texts/67", "parent": { - "$ref": "#/texts/62" + "$ref": "#/texts/66" }, "children": [], "content_layer": "body", @@ -1616,9 +1740,9 @@ "text": "Treatment effectiveness depends upon both drug efficacy (ability to kill adult worms, ability to kill Mf, drug resistance, drug quality) and implementation of MDA (coverage, compliance, number of rounds) [14,16]. Ivermectin is less effective against adult worms than DEC, and therefore it is likely that Ag reduction is slower in areas using ivermectin instead of DEC in MDA [37]. Models also have shown that MDA coverage affects prevalence, although coverage has been defined in various ways, such as median coverage, number of rounds, or individual compliance [14–16,20,38–40]. Furthermore, systematic non-compliance, or population sub-groups which consistently refuse to take medicines, has been shown to represent a threat to elimination [41,42]." }, { - "self_ref": "#/texts/64", + "self_ref": "#/texts/68", "parent": { - "$ref": "#/texts/62" + "$ref": "#/texts/66" }, "children": [], "content_layer": "body", @@ -1628,13 +1752,13 @@ "text": "We considered three approaches when analyzing the MDA data: median MDA coverage in the most recent 5 rounds, number of rounds with sufficient coverage in the most recent 5 rounds, and count of the total number of rounds. MDA coverage is considered sufficient at or above 65% of the total population who were reported to have ingested the drugs; this was used as the cut point for MDA median coverage for the most recent 5 rounds. The ‘rounds of sufficient coverage’ variable was categorized as having 2 or fewer rounds compared to 3 or more sufficient rounds. The ‘total number of MDA rounds’ variable was categorized at 5 or fewer rounds compared to 6 or more rounds ever documented in that district." }, { - "self_ref": "#/texts/65", + "self_ref": "#/texts/69", "parent": { - "$ref": "#/texts/23" + "$ref": "#/texts/27" }, "children": [ { - "$ref": "#/texts/66" + "$ref": "#/texts/70" } ], "content_layer": "body", @@ -1645,9 +1769,9 @@ "level": 3 }, { - "self_ref": "#/texts/66", + "self_ref": "#/texts/70", "parent": { - "$ref": "#/texts/65" + "$ref": "#/texts/69" }, "children": [], "content_layer": "body", @@ -1657,13 +1781,13 @@ "text": "Pre-TAS results can be influenced by the implementation of the survey itself, including the use of a particular diagnostic test, the selection of sites, the timing of survey, and the appropriate application of methods for population recruitment and diagnostic test adminstration. We included two variables in the pre-TAS implementation domain: `type of diagnostic method used’ and `diagnostic test used.’ The ‘type of diagnostic method used’ variable categorized districts by either using Mf or Ag. The ‘diagnostic test used’ variable examined Mf (reference category) compared to ICT and compared to FTS (categorical variable with 3 values). This approach was used to compare each test to each other. Countries switched from ICT to FTS during 2016, while Mf testing continued to be used throughout the time period of study." }, { - "self_ref": "#/texts/67", + "self_ref": "#/texts/71", "parent": { "$ref": "#/texts/17" }, "children": [ { - "$ref": "#/texts/68" + "$ref": "#/texts/72" } ], "content_layer": "body", @@ -1674,9 +1798,9 @@ "level": 2 }, { - "self_ref": "#/texts/68", + "self_ref": "#/texts/72", "parent": { - "$ref": "#/texts/67" + "$ref": "#/texts/71" }, "children": [], "content_layer": "body", @@ -1686,16 +1810,16 @@ "text": "The dataset, summarized at the district level, included information from 568 districts where a pre-TAS was being implemented for the first time. A total of 14 districts were removed from the final analysis due to missing data related to the following points: geospatial boundaries (4), baseline prevalence (4), and MDA coverage (6). The final analysis dataset had 554 districts." }, { - "self_ref": "#/texts/69", + "self_ref": "#/texts/73", "parent": { "$ref": "#/texts/17" }, "children": [ { - "$ref": "#/texts/70" + "$ref": "#/texts/74" }, { - "$ref": "#/groups/5" + "$ref": "#/groups/9" } ], "content_layer": "body", @@ -1706,9 +1830,9 @@ "level": 2 }, { - "self_ref": "#/texts/70", + "self_ref": "#/texts/74", "parent": { - "$ref": "#/texts/69" + "$ref": "#/texts/73" }, "children": [], "content_layer": "body", @@ -1718,9 +1842,9 @@ "text": "Statistical analysis and modeling were done with Stata MP 15.1 (College Station, TX). Descriptive statistics comparing various variables to the principle outcome were performed. Significant differences were identified using a chi-square test. A generalized linear model (GLM) with a log link and binomial error distribution—which estimates relative risks—was developed using forward stepwise modeling methods (called log-binomial model). Models with higher pseudo-r-squared and lower Akaike information criterion (AIC) were retained at each step. Pseudo-r-squared is a value between 0 and 1 with the higher the value, the better the model is at predicting the outcome of interest. AIC values are used to compare the relative quality of models compared to each other; in general, a lower value indicates a better model. Variables were tested by factor group. Once a variable was selected from the group, no other variable in that same group was eligible to be included in the final model due to issues of collinearity and small sample sizes. Interaction between terms in the model was tested after model selection, and interaction terms that modified the original terms’ significance were included in the final model. Overall, the number of potential variables able to be included in the model remained low due to the relatively small number of failure results (13%) in the dataset. Furthermore, the models with more than 3 variables and one interaction term either were unstable (indicated by very large confidence interval widths) or did not improve the model by being significant predictors or by modifying other parameters already in the model. These models were at heightened risk of non-convergence; we limited the number of variables accordingly." }, { - "self_ref": "#/texts/71", + "self_ref": "#/texts/75", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/9" }, "children": [], "content_layer": "body", @@ -1730,9 +1854,9 @@ "text": "Sensitivity analysis was performed for the final log-binomial model to test for the validity of results under different parameters by excluding some sub-sets of districts from the dataset and rerunning the model. This analysis was done to understand the robustness of the model when (1) excluding all districts in Cameroon, (2) including only districts in Africa, (3) including only districts with" }, { - "self_ref": "#/texts/72", + "self_ref": "#/texts/76", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/9" }, "children": [], "content_layer": "body", @@ -1749,9 +1873,9 @@ } }, { - "self_ref": "#/texts/73", + "self_ref": "#/texts/77", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/9" }, "children": [], "content_layer": "body", @@ -1761,9 +1885,9 @@ "text": "." }, { - "self_ref": "#/texts/74", + "self_ref": "#/texts/78", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/9" }, "children": [], "content_layer": "body", @@ -1780,9 +1904,9 @@ } }, { - "self_ref": "#/texts/75", + "self_ref": "#/texts/79", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/9" }, "children": [], "content_layer": "body", @@ -1792,9 +1916,9 @@ "text": "parasite, and (4) including only districts with" }, { - "self_ref": "#/texts/76", + "self_ref": "#/texts/80", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/9" }, "children": [], "content_layer": "body", @@ -1811,9 +1935,9 @@ } }, { - "self_ref": "#/texts/77", + "self_ref": "#/texts/81", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/9" }, "children": [], "content_layer": "body", @@ -1823,13 +1947,13 @@ "text": "as the primary vector. The sensitivity analysis excluding Cameroon was done for two reasons. First, Cameroon had the most pre-TAS results included, but no failures. Second, 70% of the Cameroon districts included in the analysis are co-endemic for loiasis. Given that diagnostic tests used in LF mapping have since been shown to cross-react with loiasis, there is some concern that these districts might not have been truly LF-endemic [43,44]." }, { - "self_ref": "#/texts/78", + "self_ref": "#/texts/82", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/79" + "$ref": "#/texts/83" }, { "$ref": "#/pictures/0" @@ -1838,28 +1962,28 @@ "$ref": "#/pictures/1" }, { - "$ref": "#/groups/6" + "$ref": "#/groups/10" }, { "$ref": "#/pictures/2" }, { - "$ref": "#/texts/86" + "$ref": "#/texts/90" }, { - "$ref": "#/texts/87" + "$ref": "#/texts/91" }, { "$ref": "#/pictures/3" }, { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, { "$ref": "#/tables/1" }, { - "$ref": "#/texts/103" + "$ref": "#/texts/107" }, { "$ref": "#/pictures/4" @@ -1873,9 +1997,9 @@ "level": 1 }, { - "self_ref": "#/texts/79", + "self_ref": "#/texts/83", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -1885,7 +2009,7 @@ "text": "The overall pre-TAS pass rate for the districts included in this analysis was 87% (74 failures in 554 districts). Nearly 40% of the 554 districts were from Cameroon (134) and Tanzania (87) (Fig 1). No districts in Bangladesh, Cameroon, Mali, or Uganda failed a pre-TAS in this data set; over 25% of districts in Burkina Faso, Ghana, Haiti, Nepal, and Sierra Leone failed pre-TAS in this data set. Baseline prevalence varied widely within and between the 13 countries. Fig 2 shows the highest, lowest, and median baseline prevalence in the study districts by country. Burkina Faso had the highest median baseline prevalence at 52% and Burkina Faso, Tanzania, and Ghana all had at least one district with a very high baseline of over 70%. In Mali, Indonesia, Benin, and Bangladesh, all districts had baseline prevalences below 20%." }, { - "self_ref": "#/texts/80", + "self_ref": "#/texts/84", "parent": { "$ref": "#/body" }, @@ -1897,7 +2021,7 @@ "text": "Fig 1 Number of pre-TAS by country." }, { - "self_ref": "#/texts/81", + "self_ref": "#/texts/85", "parent": { "$ref": "#/body" }, @@ -1909,9 +2033,9 @@ "text": "Fig 2 District-level baseline prevalence by country." }, { - "self_ref": "#/texts/82", + "self_ref": "#/texts/86", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/10" }, "children": [], "content_layer": "body", @@ -1921,9 +2045,9 @@ "text": "Fig 3 shows the unadjusted analysis for key variables by pre-TAS result. Variables statistically significantly associated with failure (p-value ≤0.05) included higher baseline prevalence at or above 5% or 10%, FTS diagnostic test, primary vector of" }, { - "self_ref": "#/texts/83", + "self_ref": "#/texts/87", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/10" }, "children": [], "content_layer": "body", @@ -1940,9 +2064,9 @@ } }, { - "self_ref": "#/texts/84", + "self_ref": "#/texts/88", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/10" }, "children": [], "content_layer": "body", @@ -1952,7 +2076,7 @@ "text": ", treatment with DEC-ALB, higher elevation, higher population density, higher EVI, higher annual rainfall, and six or more rounds of MDA. Variables that were not significantly associated with pre-TAS failure included diagnostic method used (Ag or Mf), parasite, co-endemicity for onchocerciasis, median MDA coverage, and sufficient rounds of MDA." }, { - "self_ref": "#/texts/85", + "self_ref": "#/texts/89", "parent": { "$ref": "#/body" }, @@ -1964,9 +2088,9 @@ "text": "Fig 3 Percent pre-TAS failure by each characteristic (unadjusted)." }, { - "self_ref": "#/texts/86", + "self_ref": "#/texts/90", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -1976,9 +2100,9 @@ "text": "The final log-binomial model included the variables of baseline prevalence ≥10%, the diagnostic test used (FTS and ICT), and elevation. The final model also included a significant interaction term between high baseline and diagnostic test used." }, { - "self_ref": "#/texts/87", + "self_ref": "#/texts/91", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -1988,7 +2112,7 @@ "text": "Fig 4 shows the risk ratio results with their corresponding confidence intervals. In a model with interaction between baseline and diagnostic test the baseline parameter was significant while diagnostic test and the interaction term were not. Districts with high baseline had a statistically significant (p-value ≤0.05) 2.52 times higher risk of failure (95% CI 1.37–4.64) compared to those with low baseline prevalence. The FTS diagnostic test or ICT diagnostic test alone were not significant nor was the interaction term. Additionally, districts with an elevation below 350 meters had a statistically significant (p-value ≤0.05) 3.07 times higher risk of failing pre-TAS (95% CI 1.95–4.83)." }, { - "self_ref": "#/texts/88", + "self_ref": "#/texts/92", "parent": { "$ref": "#/body" }, @@ -2000,9 +2124,9 @@ "text": "Fig 4 Adjusted risk ratios for pre-TAS failure with 95% Confidence Interval from log-binomial model." }, { - "self_ref": "#/texts/89", + "self_ref": "#/texts/93", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2012,9 +2136,9 @@ "text": "Sensitivity analyses were conducted using the same model with different subsets of the dataset including (1) all districts except for districts in Cameroon (134 total with no failures), (2) only districts in Africa, (3) only districts with" }, { - "self_ref": "#/texts/90", + "self_ref": "#/texts/94", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2031,9 +2155,9 @@ } }, { - "self_ref": "#/texts/91", + "self_ref": "#/texts/95", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2043,9 +2167,9 @@ "text": "." }, { - "self_ref": "#/texts/92", + "self_ref": "#/texts/96", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2062,9 +2186,9 @@ } }, { - "self_ref": "#/texts/93", + "self_ref": "#/texts/97", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2074,9 +2198,9 @@ "text": ", and (4) only districts with" }, { - "self_ref": "#/texts/94", + "self_ref": "#/texts/98", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2093,9 +2217,9 @@ } }, { - "self_ref": "#/texts/95", + "self_ref": "#/texts/99", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2105,9 +2229,9 @@ "text": "as primary vector. The results of the sensitivity models (Table 2) indicate an overall robust model. High baseline and lower elevation remained significant across all the models. The ICT diagnostic test used remains insignificant across all models. The FTS diagnostic test was positively significant in model 1 and negatively significant in model 4. The interaction term of baseline prevalence and FTS diagnostic test was significant in three models though the estimate was unstable in the" }, { - "self_ref": "#/texts/96", + "self_ref": "#/texts/100", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2124,9 +2248,9 @@ } }, { - "self_ref": "#/texts/97", + "self_ref": "#/texts/101", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2136,9 +2260,9 @@ "text": "." }, { - "self_ref": "#/texts/98", + "self_ref": "#/texts/102", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2155,9 +2279,9 @@ } }, { - "self_ref": "#/texts/99", + "self_ref": "#/texts/103", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2167,9 +2291,9 @@ "text": "-only and" }, { - "self_ref": "#/texts/100", + "self_ref": "#/texts/104", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2186,9 +2310,9 @@ } }, { - "self_ref": "#/texts/101", + "self_ref": "#/texts/105", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/11" }, "children": [], "content_layer": "body", @@ -2198,7 +2322,7 @@ "text": "-only models (models 3 and 4 respectively), as signified by large confidence intervals." }, { - "self_ref": "#/texts/102", + "self_ref": "#/texts/106", "parent": { "$ref": "#/body" }, @@ -2210,9 +2334,9 @@ "text": "Table 2 Adjusted risk ratios for pre-TAS failure from log-binomial model sensitivity analysis." }, { - "self_ref": "#/texts/103", + "self_ref": "#/texts/107", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -2222,7 +2346,7 @@ "text": "Overall 74 districts in the dataset failed pre-TAS. Fig 5 summarizes the likelihood of failure by variable combinations identified in the log-binomial model. For those districts with a baseline prevalence ≥10% that used a FTS diagnostic test and have an average elevation below 350 meters (Combination C01), 87% of the 23 districts failed. Of districts with high baseline that used an ICT diagnostic test and have a low average elevation (C02) 45% failed. Overall, combinations with high baseline and low elevation C01, C02, and C04 accounted for 51% of all the failures (38 of 74)." }, { - "self_ref": "#/texts/104", + "self_ref": "#/texts/108", "parent": { "$ref": "#/body" }, @@ -2234,37 +2358,37 @@ "text": "Fig 5 Analysis of failures by model combinations." }, { - "self_ref": "#/texts/105", + "self_ref": "#/texts/109", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/groups/8" + "$ref": "#/groups/12" }, { - "$ref": "#/texts/109" + "$ref": "#/texts/113" }, { - "$ref": "#/groups/9" + "$ref": "#/groups/13" }, { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, { - "$ref": "#/texts/129" + "$ref": "#/texts/133" }, { - "$ref": "#/texts/130" + "$ref": "#/texts/134" }, { - "$ref": "#/texts/131" + "$ref": "#/texts/135" }, { - "$ref": "#/texts/132" + "$ref": "#/texts/136" } ], "content_layer": "body", @@ -2275,9 +2399,9 @@ "level": 1 }, { - "self_ref": "#/texts/106", + "self_ref": "#/texts/110", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/12" }, "children": [], "content_layer": "body", @@ -2287,9 +2411,9 @@ "text": "This paper reports for the first time factors associated with pre-TAS results from a multi-country analysis. Variables significantly associated with failure were higher baseline prevalence and lower elevation. Districts with a baseline prevalence of 10% or more were at 2.52 times higher risk to fail pre-TAS in the final log-binomial model. In the bivariate analysis, baseline prevalence above 5% was also significantly more likely to fail compared to lower baselines, which indicates that the threshold for higher baseline prevalence may be as little as 5%, similar to what was found in Goldberg" }, { - "self_ref": "#/texts/107", + "self_ref": "#/texts/111", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/12" }, "children": [], "content_layer": "body", @@ -2306,9 +2430,9 @@ } }, { - "self_ref": "#/texts/108", + "self_ref": "#/texts/112", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/12" }, "children": [], "content_layer": "body", @@ -2318,9 +2442,9 @@ "text": "., which explored ecological and socioeconomic factors associated with TAS failure [7]." }, { - "self_ref": "#/texts/109", + "self_ref": "#/texts/113", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [], "content_layer": "body", @@ -2330,9 +2454,9 @@ "text": "Though diagnostic test used was selected for the final log-binomial model, neither category (FTS or ICT) were significant after interaction with high baseline. FTS alone is significant in the bivariate analysis compared to ICT or Mf. This result is not surprising given previous research which found that FTS was more sensitive than ICT [45]." }, { - "self_ref": "#/texts/110", + "self_ref": "#/texts/114", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", @@ -2342,9 +2466,9 @@ "text": "Elevation was the only environmental domain variable selected for the final log-binomial model during the model selection process, with areas of lower elevation (<350m) found to be at 3.07 times higher risk to fail pre-TAS compared to districts with a higher elevation. Similar results related to elevation were found in previous studies [8,31], including Goldberg" }, { - "self_ref": "#/texts/111", + "self_ref": "#/texts/115", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", @@ -2361,9 +2485,9 @@ } }, { - "self_ref": "#/texts/112", + "self_ref": "#/texts/116", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", @@ -2373,9 +2497,9 @@ "text": ". [7], who used a cutoff of 200 meters. Elevation likely also encompasses some related environmental concepts, such as vector habitat, greenness (EVI), or rainfall, which impact vector chances of survival." }, { - "self_ref": "#/texts/113", + "self_ref": "#/texts/117", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2385,9 +2509,9 @@ "text": "The small number of failures overall prevented the inclusion of a large number of variables in the final log-binomial model. However, other variables that are associated with failure as identified in the bivariate analyses, such as" }, { - "self_ref": "#/texts/114", + "self_ref": "#/texts/118", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2404,9 +2528,9 @@ } }, { - "self_ref": "#/texts/115", + "self_ref": "#/texts/119", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2416,9 +2540,9 @@ "text": "vector, higher population density, higher EVI, higher rainfall and more rounds of MDA, should not be discounted when making programmatic decisions. Other models have shown that" }, { - "self_ref": "#/texts/116", + "self_ref": "#/texts/120", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2435,9 +2559,9 @@ } }, { - "self_ref": "#/texts/117", + "self_ref": "#/texts/121", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2447,9 +2571,9 @@ "text": "as the predominant vector in a district, compared to" }, { - "self_ref": "#/texts/118", + "self_ref": "#/texts/122", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2466,9 +2590,9 @@ } }, { - "self_ref": "#/texts/119", + "self_ref": "#/texts/123", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, "children": [], "content_layer": "body", @@ -2478,9 +2602,9 @@ "text": ", results in more intense interventions needed to reach elimination [24,41]. Higher population density, which was also found to predict TAS failure [7], could be related to different vector species’ transmission dynamics in urban areas, as well as the fact that MDAs are harder to conduct and to accurately measure in urban areas [46,47]. Both higher enhanced vegetation index (>0.3) and higher rainfall (>700 mm per year) contribute to expansion of vector habitats and population. Additionally, having more than five rounds of MDA before pre-TAS was also statistically significantly associated with higher failure in the bivariate analysis. It is unclear why higher number of rounds is associated with first pre-TAS failure given that other research has shown the opposite [15,16]." }, { - "self_ref": "#/texts/120", + "self_ref": "#/texts/124", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2490,9 +2614,9 @@ "text": "All other variables included in this analysis were not significantly associated with pre-TAS failure in our analysis. Goldberg" }, { - "self_ref": "#/texts/121", + "self_ref": "#/texts/125", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2509,9 +2633,9 @@ } }, { - "self_ref": "#/texts/122", + "self_ref": "#/texts/126", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2521,9 +2645,9 @@ "text": ". found" }, { - "self_ref": "#/texts/123", + "self_ref": "#/texts/127", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2540,9 +2664,9 @@ } }, { - "self_ref": "#/texts/124", + "self_ref": "#/texts/128", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2552,9 +2676,9 @@ "text": "spp. to be significantly associated with failure, but our results did not. This is likely due in part to the small number of districts with" }, { - "self_ref": "#/texts/125", + "self_ref": "#/texts/129", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2571,9 +2695,9 @@ } }, { - "self_ref": "#/texts/126", + "self_ref": "#/texts/130", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2583,9 +2707,9 @@ "text": "spp. in our dataset (6%) compared to 46% in the Goldberg" }, { - "self_ref": "#/texts/127", + "self_ref": "#/texts/131", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2602,9 +2726,9 @@ } }, { - "self_ref": "#/texts/128", + "self_ref": "#/texts/132", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", @@ -2614,9 +2738,9 @@ "text": ". article [7]. MDA coverage levels were not significantly associated with pre-TAS failure, likely due to the lack of variance in the coverage data since WHO guidance dictates a minimum of five rounds of MDA with ≥65% epidemiological coverage to be eligible to implement pre-TAS. It should not be interpreted as evidence that high MDA coverage levels are not necessary to lower prevalence." }, { - "self_ref": "#/texts/129", + "self_ref": "#/texts/133", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [], "content_layer": "body", @@ -2626,9 +2750,9 @@ "text": "Limitations to this study include data sources, excluded data, unreported data, misassigned data, and aggregation of results at the district level. The main data sources for this analysis were programmatic data, which may be less accurate than data collected specifically for research purposes. This is particularly true of the MDA coverage data, where some countries report data quality challenges in areas of instability or frequent population migration. Even though risk factors such as age, sex, compliance with MDA, and use of bednets have been shown to influence infection in individuals [40,48–50], we could not include factors from the human host domain in our analysis, as data sets were aggregated at site level and did not include individual information. In addition, vector control data were not universally available across the 13 countries and thus were not included in the analysis, despite studies showing that vector control has an impact on reducing LF prevalence [41,48,51–53]." }, { - "self_ref": "#/texts/130", + "self_ref": "#/texts/134", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [], "content_layer": "body", @@ -2638,9 +2762,9 @@ "text": "Fourteen districts were excluded from the analysis because we were not able to obtain complete data for baseline prevalence, MDA coverage, or geographic boundaries. One of these districts had failed pre-TAS. It is likely these exclusions had minimal impact on the conclusions, as they represented a small number of districts and were similar to other included districts in terms of key variables. Unreported data could have occurred if a country conducted a pre-TAS that failed and then chose not to report it or reported it as a mid-term survey instead. Anecdotally, we know this has occurred occasionally, but we do not believe the practice to be widespread. Another limitation in the analysis is a potential misassignment of key variable values to a district due to changes in the district over time. Redistricting, changes in district size or composition, was pervasive in many countries during the study period; however, we expect the impact on the study outcome to be minimal, as the historical prevalence and MDA data from the “mother” districts are usually flowed down to these new “daughter” districts. However, it is possible that the split created an area of higher prevalence or lower MDA coverage than would have been found on average in the overall larger original “mother” district. Finally, the aggregation or averaging of results to the district level may mask heterogeneity within districts. Though this impact could be substantial in districts with considerable heterogeneity, the use of median values and binomial variables mitigated the likelihood of skewing the data to extreme outliners in a district." }, { - "self_ref": "#/texts/131", + "self_ref": "#/texts/135", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [], "content_layer": "body", @@ -2650,9 +2774,9 @@ "text": "As this analysis used data across a variety of countries and epidemiological situations, the results are likely relevant for other districts in the countries examined and in countries with similar epidemiological backgrounds. In general, as more data become available at site level through the increased use of electronic data collection tools, further analysis of geospatial variables and associations will be possible. For example, with the availability of GPS coordinates, it may become possible to analyze outcomes by site and to link the geospatial environmental domain variables at a smaller scale. Future analyses also might seek to include information from coverage surveys or qualitative research studies on vector control interventions such as bed net usage, MDA compliance, population movement, and sub-populations that might be missed during MDA. Future pre-TAS using electronic data collection could include sex and age of individuals included in the survey." }, { - "self_ref": "#/texts/132", + "self_ref": "#/texts/136", "parent": { - "$ref": "#/texts/105" + "$ref": "#/texts/109" }, "children": [], "content_layer": "body", @@ -2662,13 +2786,13 @@ "text": "This paper provides evidence from analysis of 554 districts and 13 countries on the factors associated with pre-TAS results. Baseline prevalence, elevation, vector, population density, EVI, rainfall, and number of MDA rounds were all significant in either bivariate or multivariate analyses. This information along with knowledge of local context can help countries more effectively plan pre-TAS and forecast program activities, such as the potential need for more than five rounds of MDA in areas with high baseline and/or low elevation." }, { - "self_ref": "#/texts/133", + "self_ref": "#/texts/137", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/134" + "$ref": "#/texts/138" } ], "content_layer": "body", @@ -2679,9 +2803,9 @@ "level": 1 }, { - "self_ref": "#/texts/134", + "self_ref": "#/texts/138", "parent": { - "$ref": "#/texts/133" + "$ref": "#/texts/137" }, "children": [], "content_layer": "body", @@ -2691,13 +2815,13 @@ "text": "The authors would like to thank all those involved from the Ministries of Health, volunteers and community members in the sentinel and spot-check site surveys for their tireless commitment to ridding the world of LF. In addition, gratitude is given to Joseph Koroma and all the partners, including USAID, RTI International, FHI 360, IMA World Health, and Helen Keller International, who supported the surveys financially and technically." }, { - "self_ref": "#/texts/135", + "self_ref": "#/texts/139", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/groups/12" + "$ref": "#/groups/16" } ], "content_layer": "body", @@ -2708,9 +2832,9 @@ "level": 1 }, { - "self_ref": "#/texts/136", + "self_ref": "#/texts/140", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2722,9 +2846,9 @@ "marker": "" }, { - "self_ref": "#/texts/137", + "self_ref": "#/texts/141", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2736,9 +2860,9 @@ "marker": "" }, { - "self_ref": "#/texts/138", + "self_ref": "#/texts/142", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2750,9 +2874,9 @@ "marker": "" }, { - "self_ref": "#/texts/139", + "self_ref": "#/texts/143", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2764,9 +2888,9 @@ "marker": "" }, { - "self_ref": "#/texts/140", + "self_ref": "#/texts/144", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2778,9 +2902,9 @@ "marker": "" }, { - "self_ref": "#/texts/141", + "self_ref": "#/texts/145", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2792,9 +2916,9 @@ "marker": "" }, { - "self_ref": "#/texts/142", + "self_ref": "#/texts/146", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2806,9 +2930,9 @@ "marker": "" }, { - "self_ref": "#/texts/143", + "self_ref": "#/texts/147", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2820,9 +2944,9 @@ "marker": "" }, { - "self_ref": "#/texts/144", + "self_ref": "#/texts/148", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2834,9 +2958,9 @@ "marker": "" }, { - "self_ref": "#/texts/145", + "self_ref": "#/texts/149", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2848,9 +2972,9 @@ "marker": "" }, { - "self_ref": "#/texts/146", + "self_ref": "#/texts/150", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2862,9 +2986,9 @@ "marker": "" }, { - "self_ref": "#/texts/147", + "self_ref": "#/texts/151", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2876,9 +3000,9 @@ "marker": "" }, { - "self_ref": "#/texts/148", + "self_ref": "#/texts/152", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2890,9 +3014,9 @@ "marker": "" }, { - "self_ref": "#/texts/149", + "self_ref": "#/texts/153", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2904,9 +3028,9 @@ "marker": "" }, { - "self_ref": "#/texts/150", + "self_ref": "#/texts/154", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2918,9 +3042,9 @@ "marker": "" }, { - "self_ref": "#/texts/151", + "self_ref": "#/texts/155", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2932,9 +3056,9 @@ "marker": "" }, { - "self_ref": "#/texts/152", + "self_ref": "#/texts/156", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2946,9 +3070,9 @@ "marker": "" }, { - "self_ref": "#/texts/153", + "self_ref": "#/texts/157", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2960,9 +3084,9 @@ "marker": "" }, { - "self_ref": "#/texts/154", + "self_ref": "#/texts/158", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2974,9 +3098,9 @@ "marker": "" }, { - "self_ref": "#/texts/155", + "self_ref": "#/texts/159", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -2988,9 +3112,9 @@ "marker": "" }, { - "self_ref": "#/texts/156", + "self_ref": "#/texts/160", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3002,9 +3126,9 @@ "marker": "" }, { - "self_ref": "#/texts/157", + "self_ref": "#/texts/161", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3016,9 +3140,9 @@ "marker": "" }, { - "self_ref": "#/texts/158", + "self_ref": "#/texts/162", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3030,9 +3154,9 @@ "marker": "" }, { - "self_ref": "#/texts/159", + "self_ref": "#/texts/163", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3044,9 +3168,9 @@ "marker": "" }, { - "self_ref": "#/texts/160", + "self_ref": "#/texts/164", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3058,9 +3182,9 @@ "marker": "" }, { - "self_ref": "#/texts/161", + "self_ref": "#/texts/165", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3072,9 +3196,9 @@ "marker": "" }, { - "self_ref": "#/texts/162", + "self_ref": "#/texts/166", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3086,9 +3210,9 @@ "marker": "" }, { - "self_ref": "#/texts/163", + "self_ref": "#/texts/167", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3100,9 +3224,9 @@ "marker": "" }, { - "self_ref": "#/texts/164", + "self_ref": "#/texts/168", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3114,9 +3238,9 @@ "marker": "" }, { - "self_ref": "#/texts/165", + "self_ref": "#/texts/169", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3128,9 +3252,9 @@ "marker": "" }, { - "self_ref": "#/texts/166", + "self_ref": "#/texts/170", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3142,9 +3266,9 @@ "marker": "" }, { - "self_ref": "#/texts/167", + "self_ref": "#/texts/171", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3156,9 +3280,9 @@ "marker": "" }, { - "self_ref": "#/texts/168", + "self_ref": "#/texts/172", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3170,9 +3294,9 @@ "marker": "" }, { - "self_ref": "#/texts/169", + "self_ref": "#/texts/173", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3184,9 +3308,9 @@ "marker": "" }, { - "self_ref": "#/texts/170", + "self_ref": "#/texts/174", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3198,9 +3322,9 @@ "marker": "" }, { - "self_ref": "#/texts/171", + "self_ref": "#/texts/175", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3212,9 +3336,9 @@ "marker": "" }, { - "self_ref": "#/texts/172", + "self_ref": "#/texts/176", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3226,9 +3350,9 @@ "marker": "" }, { - "self_ref": "#/texts/173", + "self_ref": "#/texts/177", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3240,9 +3364,9 @@ "marker": "" }, { - "self_ref": "#/texts/174", + "self_ref": "#/texts/178", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3254,9 +3378,9 @@ "marker": "" }, { - "self_ref": "#/texts/175", + "self_ref": "#/texts/179", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3268,9 +3392,9 @@ "marker": "" }, { - "self_ref": "#/texts/176", + "self_ref": "#/texts/180", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3282,9 +3406,9 @@ "marker": "" }, { - "self_ref": "#/texts/177", + "self_ref": "#/texts/181", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3296,9 +3420,9 @@ "marker": "" }, { - "self_ref": "#/texts/178", + "self_ref": "#/texts/182", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3310,9 +3434,9 @@ "marker": "" }, { - "self_ref": "#/texts/179", + "self_ref": "#/texts/183", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3324,9 +3448,9 @@ "marker": "" }, { - "self_ref": "#/texts/180", + "self_ref": "#/texts/184", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3338,9 +3462,9 @@ "marker": "" }, { - "self_ref": "#/texts/181", + "self_ref": "#/texts/185", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3352,9 +3476,9 @@ "marker": "" }, { - "self_ref": "#/texts/182", + "self_ref": "#/texts/186", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3366,9 +3490,9 @@ "marker": "" }, { - "self_ref": "#/texts/183", + "self_ref": "#/texts/187", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3380,9 +3504,9 @@ "marker": "" }, { - "self_ref": "#/texts/184", + "self_ref": "#/texts/188", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3394,9 +3518,9 @@ "marker": "" }, { - "self_ref": "#/texts/185", + "self_ref": "#/texts/189", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3408,9 +3532,9 @@ "marker": "" }, { - "self_ref": "#/texts/186", + "self_ref": "#/texts/190", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3422,9 +3546,9 @@ "marker": "" }, { - "self_ref": "#/texts/187", + "self_ref": "#/texts/191", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3436,9 +3560,9 @@ "marker": "" }, { - "self_ref": "#/texts/188", + "self_ref": "#/texts/192", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", @@ -3454,7 +3578,7 @@ { "self_ref": "#/pictures/0", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -3462,7 +3586,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/80" + "$ref": "#/texts/84" } ], "references": [], @@ -3472,7 +3596,7 @@ { "self_ref": "#/pictures/1", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -3480,7 +3604,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/81" + "$ref": "#/texts/85" } ], "references": [], @@ -3490,7 +3614,7 @@ { "self_ref": "#/pictures/2", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -3498,7 +3622,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/85" + "$ref": "#/texts/89" } ], "references": [], @@ -3508,7 +3632,7 @@ { "self_ref": "#/pictures/3", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -3516,7 +3640,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/88" + "$ref": "#/texts/92" } ], "references": [], @@ -3526,7 +3650,7 @@ { "self_ref": "#/pictures/4", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -3534,7 +3658,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/104" + "$ref": "#/texts/108" } ], "references": [], @@ -3548,7 +3672,14 @@ "parent": { "$ref": "#/texts/17" }, - "children": [], + "children": [ + { + "$ref": "#/groups/2" + }, + { + "$ref": "#/groups/4" + } + ], "content_layer": "body", "label": "table", "prov": [], @@ -4235,7 +4366,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/2" + } }, { "row_span": 1, @@ -4547,7 +4681,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/4" + } }, { "row_span": 1, @@ -7353,7 +7490,7 @@ { "self_ref": "#/tables/1", "parent": { - "$ref": "#/texts/78" + "$ref": "#/texts/82" }, "children": [], "content_layer": "body", @@ -7361,7 +7498,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/102" + "$ref": "#/texts/106" } ], "references": [], diff --git a/tests/data/jats/groundtruth/pntd.0008301.nxml.md b/tests/data/jats/groundtruth/pntd.0008301.nxml.md index f3c86f3713..b67841c7c2 100644 --- a/tests/data/jats/groundtruth/pntd.0008301.nxml.md +++ b/tests/data/jats/groundtruth/pntd.0008301.nxml.md @@ -39,10 +39,10 @@ Table 1 Categorization of potential factors influencing pre-TAS results. | Agent | Parasite | Parasite | Predominate parasite in district | W. bancrofti & mixed | Binary value | 2018 | Programmatic data | | Environment | Vector | Vector | Predominate vector in district | Anopheles & Mansonia | Binary value | 2018 | Country expert | | Environment | Geography | Elevation | Elevation measured in meters | >350 | Mean | 2000 | CGIAR-CSI SRTM [9] | -| Environment | Geography | District area | Area measured in km2 | >2,500 | Maximum sum | Static | Programmatic data | +| Environment | Geography | District area | Area measured in km 2 | >2,500 | Maximum sum | Static | Programmatic data | | Environment | Climate | EVI | Enhanced vegetation index | > 0.3 | Mean | 2015 | MODIS [10] | | Environment | Climate | Rainfall | Annual rainfall measured in mm | ≤ 700 | Mean | 2015 | CHIRPS [11] | -| Environment | Socio-economic | Population density | Number of people per km2 | ≤ 100 | Mean | 2015 | WorldPop [12] | +| Environment | Socio-economic | Population density | Number of people per km 2 | ≤ 100 | Mean | 2015 | WorldPop [12] | | Environment | Socio-economic | Nighttime lights | Nighttime light index from 0 to 63 | >1.5 | Mean | 2015 | VIIRS [13] | | Environment | Co-endemicity | Co-endemic for onchocerciasis | Part or all of district is also endemic for onchocerciases | Non-endemic | Binary value | 2018 | Programmatic data | | MDA | Drug efficacy | Drug package | DEC-ALB or IVM-ALB | DEC-ALB | Binary value | 2018 | Programmatic data | diff --git a/tests/data/jats/groundtruth/pone.0234687.nxml.itxt b/tests/data/jats/groundtruth/pone.0234687.nxml.itxt index 05490bad52..e2c64199db 100644 --- a/tests/data/jats/groundtruth/pone.0234687.nxml.itxt +++ b/tests/data/jats/groundtruth/pone.0234687.nxml.itxt @@ -59,540 +59,867 @@ item-0 at level 0: unspecified: group _root_ item-57 at level 4: text: ECM = Milk production × (0.0929 ... characteristics described in Table 1. item-58 at level 4: table with [13x3] item-58 at level 5: caption: Table 1 Descriptive characteristics of the herd. - item-59 at level 3: section_header: Data sources and livestock system description - item-60 at level 4: inline: group group - item-61 at level 5: text: The individual feed requirements ... cows that received both 75 and 50% of - item-62 at level 5: text: ad libitum - item-63 at level 5: text: TMR intake with access to grazing a tropical pasture (pearl-millet, - item-64 at level 5: text: Pennisetum glaucum - item-65 at level 5: text: ‘Campeiro’) compared to cows receiving + item-59 at level 5: unspecified: group rich_cell_group_1_1_2 + item-60 at level 6: inline: group group + item-61 at level 7: text: kg year + item-62 at level 7: text: -1 + item-63 at level 3: section_header: Data sources and livestock system description + item-64 at level 4: inline: group group + item-65 at level 5: text: The individual feed requirements ... cows that received both 75 and 50% of item-66 at level 5: text: ad libitum - item-67 at level 5: text: TMR intake. Cows grazing on a temperate pasture (ryegrass, - item-68 at level 5: text: Lolium multiflorum - item-69 at level 5: text: ‘Maximus’) did not need changes to ECM production compared to the + item-67 at level 5: text: TMR intake with access to grazing a tropical pasture (pearl-millet, + item-68 at level 5: text: Pennisetum glaucum + item-69 at level 5: text: ‘Campeiro’) compared to cows receiving item-70 at level 5: text: ad libitum - item-71 at level 5: text: TMR intake group. - item-72 at level 4: inline: group group - item-73 at level 5: text: Using experimental data, three s ... evaluated during the lactation period: + item-71 at level 5: text: TMR intake. Cows grazing on a temperate pasture (ryegrass, + item-72 at level 5: text: Lolium multiflorum + item-73 at level 5: text: ‘Maximus’) did not need changes to ECM production compared to the item-74 at level 5: text: ad libitum - item-75 at level 5: text: TMR intake, and 75, and 50% of - item-76 at level 5: text: ad libitum - item-77 at level 5: text: TMR intake with access to grazin ... nction of month ([26], Civiero et al., - item-78 at level 5: text: in press - item-79 at level 5: text: ). From April to October (210 da ... med during an entire lactation period. - item-80 at level 3: section_header: Impact assessment - item-81 at level 4: inline: group group - item-82 at level 5: text: The CO - item-83 at level 5: text: 2 - item-84 at level 5: text: e emissions were calculated by multiplying the emissions of CO - item-85 at level 5: text: 2 - item-86 at level 5: text: , CH - item-87 at level 5: text: 4 - item-88 at level 5: text: and N + item-75 at level 5: text: TMR intake group. + item-76 at level 4: inline: group group + item-77 at level 5: text: Using experimental data, three s ... evaluated during the lactation period: + item-78 at level 5: text: ad libitum + item-79 at level 5: text: TMR intake, and 75, and 50% of + item-80 at level 5: text: ad libitum + item-81 at level 5: text: TMR intake with access to grazin ... nction of month ([26], Civiero et al., + item-82 at level 5: text: in press + item-83 at level 5: text: ). From April to October (210 da ... med during an entire lactation period. + item-84 at level 3: section_header: Impact assessment + item-85 at level 4: inline: group group + item-86 at level 5: text: The CO + item-87 at level 5: text: 2 + item-88 at level 5: text: e emissions were calculated by multiplying the emissions of CO item-89 at level 5: text: 2 - item-90 at level 5: text: O by their 100-year global warming potential (GWP - item-91 at level 5: text: 100 - item-92 at level 5: text: ), based on IPCC assessment report 5 (AR5; [27]). The values of GWP - item-93 at level 5: text: 100 - item-94 at level 5: text: are 1, 28 and 265 for CO - item-95 at level 5: text: 2 - item-96 at level 5: text: , CH - item-97 at level 5: text: 4 - item-98 at level 5: text: and N + item-90 at level 5: text: , CH + item-91 at level 5: text: 4 + item-92 at level 5: text: and N + item-93 at level 5: text: 2 + item-94 at level 5: text: O by their 100-year global warming potential (GWP + item-95 at level 5: text: 100 + item-96 at level 5: text: ), based on IPCC assessment report 5 (AR5; [27]). The values of GWP + item-97 at level 5: text: 100 + item-98 at level 5: text: are 1, 28 and 265 for CO item-99 at level 5: text: 2 - item-100 at level 5: text: O, respectively. - item-101 at level 3: section_header: Feed production - item-102 at level 4: section_header: Diets composition - item-103 at level 5: inline: group group - item-104 at level 6: text: The DM intake of each ingredient ... ennial tropical pasture (kikuyu grass, - item-105 at level 6: text: Pennisetum clandestinum - item-106 at level 6: text: ). The DM intake of calves, heif ... meet the net energy for lactation (NE - item-107 at level 6: text: L - item-108 at level 6: text: ) and metabolizable protein (MP) ... grated in the software INRAtion 4.07 ( - item-109 at level 6: text: https://www.inration.educagri.fr/fr/forum.php - item-110 at level 6: text: ). The nutrient intake was calcu ... collected throughout the experiments. - item-111 at level 5: table with [21x11] - item-111 at level 6: caption: Table 2 Dairy cows’ diets in different scenariosa. - item-112 at level 4: section_header: GHG emissions from crop and pasture production - item-113 at level 5: inline: group group - item-114 at level 6: text: GHG emission factors used for of ... s productions were 3300 and 1500 kg CO - item-115 at level 6: text: 2 - item-116 at level 6: text: e ha - item-117 at level 6: text: -1 - item-118 at level 6: text: , respectively [32]. The DM production (kg ha - item-119 at level 6: text: -1 - item-120 at level 6: text: ) of corn silage and pastures we ... onsume 70% of pastures during grazing. - item-121 at level 5: table with [9x5] - item-121 at level 6: caption: Table 3 GHG emission factors for Off- and On-farm feed production. - item-122 at level 5: inline: group group - item-123 at level 6: text: Emissions from on-farm feed prod ... ary sources were direct and indirect N - item-124 at level 6: text: 2 - item-125 at level 6: text: O-N emissions from organic and s ... tilizers and crop/pasture residues, CO - item-126 at level 6: text: 2 - item-127 at level 6: text: -C emissions from lime and urea ... well as fuel combustion. The direct N - item-128 at level 6: text: 2 - item-129 at level 6: text: O-N emission factor (kg (kg N input) - item-130 at level 6: text: -1 - item-131 at level 6: text: ) is based on a local study performed previously [37]. For indirect N - item-132 at level 6: text: 2 - item-133 at level 6: text: O-N emissions (kg N - item-134 at level 6: text: 2 - item-135 at level 6: text: O-N (kg NH - item-136 at level 6: text: 3 - item-137 at level 6: text: -N + NO - item-138 at level 6: text: x - item-139 at level 6: text: ) - item-140 at level 6: text: -1 - item-141 at level 6: text: ), as well as CO - item-142 at level 6: text: 2 - item-143 at level 6: text: -C emissions from lime + urea, d ... stures, a C sequestration of 0.57 t ha - item-144 at level 6: text: -1 - item-145 at level 6: text: was used based on a 9-year study ... red was 8.9 (no-tillage) and 14.3 L ha - item-146 at level 6: text: -1 - item-147 at level 6: text: (disking) for annual tropical an ... te pastures, respectively [40]. The CO - item-148 at level 6: text: 2 - item-149 at level 6: text: from fuel combustion was 2.7 kg CO - item-150 at level 6: text: 2 - item-151 at level 6: text: L - item-152 at level 6: text: -1 - item-153 at level 6: text: [41]. Secondary sources of emiss ... factors described by Rotz et al. [42]. - item-154 at level 5: table with [28x5] - item-154 at level 6: caption: Table 4 GHG emissions from On-farm feed production. - item-155 at level 3: section_header: Animal husbandry - item-156 at level 4: inline: group group - item-157 at level 5: text: The CH - item-158 at level 5: text: 4 - item-159 at level 5: text: emissions from enteric fermentation intensity (g (kg ECM) - item-160 at level 5: text: -1 - item-161 at level 5: text: ) was a function of estimated CH - item-162 at level 5: text: 4 - item-163 at level 5: text: yield (g (kg DM intake) - item-164 at level 5: text: -1 - item-165 at level 5: text: ), actual DM intake and ECM. The enteric CH - item-166 at level 5: text: 4 - item-167 at level 5: text: yield was estimated as a functio ... proposed by Niu et al. [43], where: CH - item-168 at level 5: text: 4 - item-169 at level 5: text: yield (g (kg DM intake) - item-170 at level 5: text: -1 - item-171 at level 5: text: ) = 13.8 + 0.185 × NDF (% DM intake). - item-172 at level 3: section_header: Manure from confined cows and urine and dung from grazing animals - item-173 at level 4: inline: group group - item-174 at level 5: text: The CH - item-175 at level 5: text: 4 - item-176 at level 5: text: emission from manure (kg (kg ECM) - item-177 at level 5: text: -1 - item-178 at level 5: text: ) was a function of daily CH - item-179 at level 5: text: 4 - item-180 at level 5: text: emission from manure (kg cow - item-181 at level 5: text: -1 - item-182 at level 5: text: ) and daily ECM (kg cow - item-183 at level 5: text: -1 - item-184 at level 5: text: ). The daily CH - item-185 at level 5: text: 4 - item-186 at level 5: text: emission from manure was estimat ... olatile solid (VS) excreted (kg DM cow - item-187 at level 5: text: -1 - item-188 at level 5: text: ) in manure. The daily VS was es ... n an organic matter (OM) basis (kg day - item-189 at level 5: text: -1 - item-190 at level 5: text: ), NDOMI = non-digestible OM intake (kg day - item-191 at level 5: text: -1 - item-192 at level 5: text: ): (1- OM digestibility) × OM in ... .04), GE = gross energy intake (MJ day - item-193 at level 5: text: -1 - item-194 at level 5: text: ), OM = organic matter (g), 18.4 ... tor for dietary GE per kg of DM (MJ kg - item-195 at level 5: text: -1 - item-196 at level 5: text: ). - item-197 at level 4: text: The OM digestibility was estimat ... h were 31%, 26% and 46%, respectively. - item-198 at level 4: inline: group group - item-199 at level 5: text: The N - item-200 at level 5: text: 2 - item-201 at level 5: text: O-N emissions from urine and fec ... ations 10 and 12, respectively). The N - item-202 at level 5: text: 2 - item-203 at level 5: text: O emissions from stored manure a ... alculated based on the conversion of N - item-204 at level 5: text: 2 - item-205 at level 5: text: O-N emissions to N - item-206 at level 5: text: 2 - item-207 at level 5: text: O emissions, where N - item-208 at level 5: text: 2 - item-209 at level 5: text: O emissions = N - item-210 at level 5: text: 2 - item-211 at level 5: text: O-N emissions × 44/28. The emission factors were 0.002 kg N - item-212 at level 5: text: 2 - item-213 at level 5: text: O-N (kg N) - item-214 at level 5: text: -1 - item-215 at level 5: text: stored in a pit below animal confinements, and 0.02 kg N - item-216 at level 5: text: 2 - item-217 at level 5: text: O-N (kg of urine and dung) - item-218 at level 5: text: -1 - item-219 at level 5: text: deposited on pasture [38]. The indirect N - item-220 at level 5: text: 2 - item-221 at level 5: text: O emissions from storage manure ... using the IPCC [38] emission factors. - item-222 at level 3: section_header: Farm management - item-223 at level 4: text: Emissions due to farm management ... crop and pasture production’ section. - item-224 at level 4: table with [12x4] - item-224 at level 5: caption: Table 5 Factors for major resource inputs in farm management. - item-225 at level 4: inline: group group - item-226 at level 5: text: The amount of fuel use for manur ... quired for manure handling (L diesel t - item-227 at level 5: text: -1 - item-228 at level 5: text: ) [42]. The amount of manure was estimated from OM excretions (kg cow - item-229 at level 5: text: -1 - item-230 at level 5: text: ), assuming that the manure has ... me that animals stayed on confinement. - item-231 at level 4: inline: group group - item-232 at level 5: text: The emissions from fuel were est ... uired for manure handling (L) × (kg CO - item-233 at level 5: text: 2 - item-234 at level 5: text: e L - item-235 at level 5: text: -1 - item-236 at level 5: text: ) [41]. The secondary emissions ... roduction and transport of fuel (kg CO - item-237 at level 5: text: 2 - item-238 at level 5: text: e L - item-239 at level 5: text: -1 - item-240 at level 5: text: ) [41]. Emissions from manufactu ... w (t) × (kg machinery mass (kg manure) - item-241 at level 5: text: -1 - item-242 at level 5: text: × 10 - item-243 at level 5: text: −3 - item-244 at level 5: text: ) [42] × kg CO - item-245 at level 5: text: 2 - item-246 at level 5: text: e (kg machinery mass) - item-247 at level 5: text: -1 - item-248 at level 5: text: [42]. - item-249 at level 4: inline: group group - item-250 at level 5: text: Emissions from electricity for m ... ated using two emission factors (kg CO - item-251 at level 5: text: 2 - item-252 at level 5: text: kWh - item-253 at level 5: text: -1 - item-254 at level 5: text: ). The first one is based on Uni ... ivities is 0.06 kWh (kg milk produced) - item-255 at level 5: text: -1 - item-256 at level 5: text: [47]. The annual electricity use for lighting was 75 kWh cow - item-257 at level 5: text: -1 - item-258 at level 5: text: , which is the value considered ... ws in naturally ventilated barns [47]. - item-259 at level 3: section_header: Co-product allocation - item-260 at level 4: inline: group group - item-261 at level 5: text: The C footprint for milk produce ... ibed by Thoma et al. [48]. Briefly, AR - item-262 at level 5: text: milk - item-263 at level 5: text: = 1–6.04 × BMR, where - item-264 at level 5: text: : - item-265 at level 5: text: AR - item-266 at level 5: text: milk - item-267 at level 5: text: is the allocation ratio for milk ... during cow`s entire life (kg). The AR - item-268 at level 5: text: milk - item-269 at level 5: text: were 0.854 and 0.849 for TMR and ... asture scenarios, respectively. The AR - item-270 at level 5: text: milk - item-271 at level 5: text: was applied to the whole emissio ... directly assigned to milk production. - item-272 at level 3: section_header: Sensitivity analysis - item-273 at level 4: text: A sensitivity index was calculat ... ses a similar change in the footprint. - item-274 at level 2: section_header: Results and discussion - item-275 at level 3: text: The study has assessed the impac ... , feed production and electricity use. - item-276 at level 3: section_header: Greenhouse gas emissions - item-277 at level 4: inline: group group - item-278 at level 5: text: Depending on emission factors us ... 2A and 2B) or decreased by 0.04 kg CO - item-279 at level 5: text: 2 - item-280 at level 5: text: e (kg ECM) - item-281 at level 5: text: -1 - item-282 at level 5: text: (Fig 2C and 2D) in scenarios that included pastures compared to - item-283 at level 5: text: ad libitum - item-284 at level 5: text: TMR intake. Due to differences i ... values ranged from 0.92 to 1.04 kg CO - item-285 at level 5: text: 2 - item-286 at level 5: text: e (kg ECM) - item-287 at level 5: text: -1 - item-288 at level 5: text: for dairy cows receiving TMR exclusively, and from 0.88 to 1.04 kg CO - item-289 at level 5: text: 2 - item-290 at level 5: text: e (kg ECM) - item-291 at level 5: text: -1 - item-292 at level 5: text: for cows with access to pasture. ... ocal emission factors for estimating N - item-293 at level 5: text: 2 - item-294 at level 5: text: O-N emissions [37], manure emiss ... more than 5% of overall GHG emissions. - item-295 at level 4: picture - item-295 at level 5: caption: Fig 2 Overall greenhouse gas emissions in dairy cattle systems under various scenarios. TMR = ad libitum TMR intake, 75TMR = 75% of ad libitum TMR intake with access to pasture, 50TMR = 50% of ad libitum TMR intake with access to pasture. (a) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.73 kg CO2e kWh-1 [41]. (b) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]; (c) N2O emission factors for urine and dung from local data [37], feed production EF from Table 4 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. (d) N2O emission factors for urine and dung from local data [37], feed production emission factors from Table 4 accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. - item-296 at level 4: inline: group group - item-297 at level 5: text: Considering IPCC emission factors for N - item-298 at level 5: text: 2 - item-299 at level 5: text: O emissions from urine and dung ... otprint ranged from 0.99 to 1.04 kg CO - item-300 at level 5: text: 2 - item-301 at level 5: text: e (kg ECM) - item-302 at level 5: text: -1 - item-303 at level 5: text: , and was close to those reporte ... , which ranged from 0.98 to 1.16 kg CO - item-304 at level 5: text: 2 - item-305 at level 5: text: e (kg ECM) - item-306 at level 5: text: -1 - item-307 at level 5: text: . When local emission factors for N - item-308 at level 5: text: 2 - item-309 at level 5: text: O emissions from urine and dung ... without accounting for sequestered CO - item-310 at level 5: text: 2 - item-311 at level 5: text: -C from perennial pasture—0.91 kg CO - item-312 at level 5: text: 2 - item-313 at level 5: text: e (kg ECM) - item-314 at level 5: text: -1 - item-315 at level 5: text: —was lower than the range of val ... , which ranged from 0.52 to 0.89 kg CO - item-316 at level 5: text: 2 - item-317 at level 5: text: e (kg ECM) - item-318 at level 5: text: -1 - item-319 at level 5: text: . Regardless of which emission f ... nt, which ranged from 1.4 to 2.3 kg CO - item-320 at level 5: text: 2 - item-321 at level 5: text: e (kg ECM) - item-322 at level 5: text: -1 - item-323 at level 5: text: [8,55]. Thus, even though differ ... e emissions estimation, sequestered CO - item-324 at level 5: text: 2 - item-325 at level 5: text: -C, etc.), herd productivity and ... the C footprint of the dairy systems. - item-326 at level 4: inline: group group - item-327 at level 5: text: The similarity of C footprint be ... served that an increase of 1000 kg cow - item-328 at level 5: text: -1 - item-329 at level 5: text: (5000 to 6000 kg ECM) reduced the C footprint by 0.12 kg CO - item-330 at level 5: text: 2 - item-331 at level 5: text: e (kg ECM) - item-332 at level 5: text: -1 - item-333 at level 5: text: , which may explain an apparent ... milk production of around 7000 kg cow - item-334 at level 5: text: -1 - item-335 at level 5: text: . Experimental data showed a red ... of TMR was replaced by pasture access. - item-336 at level 4: inline: group group - item-337 at level 5: text: The lower C footprint in scenari ... emission factors [37] were used for N - item-338 at level 5: text: 2 - item-339 at level 5: text: O emissions from urine and dung ... enarios including pastures compared to - item-340 at level 5: text: ad libitum - item-341 at level 5: text: TMR intake. Whereas the IPCC [38] considers an emission of 0.02 kg N - item-342 at level 5: text: 2 - item-343 at level 5: text: O-N (kg N) - item-344 at level 5: text: -1 - item-345 at level 5: text: for urine and dung from grazing ... five times lower, averaging 0.004 kg N - item-346 at level 5: text: 2 - item-347 at level 5: text: O-N kg - item-348 at level 5: text: -1 - item-349 at level 5: text: [37]. - item-350 at level 3: section_header: Methane emissions - item-351 at level 4: inline: group group - item-352 at level 5: text: The enteric CH - item-353 at level 5: text: 4 - item-354 at level 5: text: intensity was similar between di ... Fig 3). The large effect of enteric CH - item-355 at level 5: text: 4 - item-356 at level 5: text: emissions on the whole C footpri ... cted, because the impact of enteric CH - item-357 at level 5: text: 4 - item-358 at level 5: text: on GHG emissions of milk product ... o range from 44 to 60% of the total CO - item-359 at level 5: text: 2 - item-360 at level 5: text: e [50,52,57,58]. However, emissi ... trate feeds are greater than 0.7 kg CO - item-361 at level 5: text: 2 - item-362 at level 5: text: e kg - item-363 at level 5: text: -1 - item-364 at level 5: text: [59], which did not happen in this study. - item-365 at level 4: picture - item-365 at level 5: caption: Fig 3 Sensitivity of the C footprint. Sensitivity index = percentage change in C footprint for a 10% change in the given emission source divided by 10% of. (a) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3, production of electricity = 0.73 kg CO2e kWh-1 [41]. (b) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3, production of electricity = 0.205 kg CO2e kWh-1 [46]; (c) N2O emission factors for urine and dung from local data [37], feed production EF from Table 4 without accounting sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. (d) N2O emission factors for urine and dung from local data [37], feed production emission factors from Table 4 accounting sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. - item-366 at level 4: inline: group group - item-367 at level 5: text: The lack of difference in enteric CH - item-368 at level 5: text: 4 - item-369 at level 5: text: emissions in different systems c ... nual temperate pastures (495 g (kg DM) - item-370 at level 5: text: -1 - item-371 at level 5: text: ) compared to corn silage (550 g (kg DM) - item-372 at level 5: text: -1 - item-373 at level 5: text: ). Hence, an expected, increase ... have shown that the actual enteric CH - item-374 at level 5: text: 4 - item-375 at level 5: text: emissions may decrease with incl ... ybean meal [60] or increase enteric CH - item-376 at level 5: text: 4 - item-377 at level 5: text: emissions when dairy cows grazin ... silage [61]. Additionally, enteric CH - item-378 at level 5: text: 4 - item-379 at level 5: text: emissions did not differ between ... same scenarios as in this study [26]. - item-380 at level 3: section_header: Emissions from excreta and feed production - item-381 at level 4: inline: group group - item-382 at level 5: text: Using IPCC emission factors for N - item-383 at level 5: text: 2 - item-384 at level 5: text: O emissions from urine and dung [38] and those from Table 3, CH - item-385 at level 5: text: 4 - item-386 at level 5: text: emissions from manure decreased 0.07 kg CO - item-387 at level 5: text: 2 - item-388 at level 5: text: e (kg ECM) - item-389 at level 5: text: -1 - item-390 at level 5: text: , but N - item-391 at level 5: text: 2 - item-392 at level 5: text: O emissions from manure increased 0.09 kg CO - item-393 at level 5: text: 2 - item-394 at level 5: text: e (kg ECM) - item-395 at level 5: text: -1 - item-396 at level 5: text: , as TMR intake was restricted to 50% - item-397 at level 5: text: ad libitum - item-398 at level 5: text: (Fig 4A). Emissions for pastures increased by 0.06 kg CO - item-399 at level 5: text: 2 - item-400 at level 5: text: e (kg ECM) - item-401 at level 5: text: -1 - item-402 at level 5: text: , whereas emissions for producin ... nd corn silage decreased by 0.09 kg CO - item-403 at level 5: text: 2 - item-404 at level 5: text: e (kg ECM) - item-405 at level 5: text: -1 - item-406 at level 5: text: , as TMR intake decreased (Fig 4 ... ctating dairy cow diets. The greater N - item-407 at level 5: text: 2 - item-408 at level 5: text: O-N emissions from manure with pasture was a consequence of higher N - item-409 at level 5: text: 2 - item-410 at level 5: text: O-N emissions due to greater CP ... g CP content from 185 to 152 g (kg DM) - item-411 at level 5: text: -1 - item-412 at level 5: text: , N intake decreased by 20% and ... g dairy cows ranged from 150 g (kg DM) - item-413 at level 5: text: -1 - item-414 at level 5: text: on TMR system to 198 g (kg DM) - item-415 at level 5: text: -1 - item-416 at level 5: text: on 50% TMR with pasture. Additio ... may not be captured by microbes [65]. - item-417 at level 4: picture - item-417 at level 5: caption: Fig 4 Greenhouse gas emissions (GHG) from manure and feed production in dairy cattle systems. TMR = ad libitum TMR intake, 75TMR = 75% of ad libitum TMR intake with access to pasture, 50TMR = 50% of ad libitum TMR intake with access to pasture. (a) N2O emission factors for urine and dung from IPCC [38]. (b) Feed production emission factors from Table 3. (c) N2O emission factors for urine and dung from local data [37]. (d) Feed production emission factors from Table 4 accounting sequestered CO2-C from perennial pasture. - item-418 at level 4: inline: group group - item-419 at level 5: text: Using local emission factors for N - item-420 at level 5: text: 2 - item-421 at level 5: text: O emissions from urine and dung ... d those from Table 4, reductions in CH - item-422 at level 5: text: 4 - item-423 at level 5: text: emissions from stocked manure, w ... iets, did not offset by increases in N - item-424 at level 5: text: 2 - item-425 at level 5: text: O emissions from excreta (Fig 4C ... much lower emission factors used for N - item-426 at level 5: text: 2 - item-427 at level 5: text: O emissions from urine and dung. ... be revised for the subtropical region. - item-428 at level 4: text: Emissions for feed production de ... act, particularly in confinements [9]. - item-429 at level 3: section_header: Farm management - item-430 at level 4: text: The lower impact of emissions fr ... greater than 5% of total C footprint. - item-431 at level 4: inline: group group - item-432 at level 5: text: Emissions from farm management d ... or electricity generation (0.205 kg CO - item-433 at level 5: text: 2 - item-434 at level 5: text: e kWh + item-100 at level 5: text: , CH + item-101 at level 5: text: 4 + item-102 at level 5: text: and N + item-103 at level 5: text: 2 + item-104 at level 5: text: O, respectively. + item-105 at level 3: section_header: Feed production + item-106 at level 4: section_header: Diets composition + item-107 at level 5: inline: group group + item-108 at level 6: text: The DM intake of each ingredient ... ennial tropical pasture (kikuyu grass, + item-109 at level 6: text: Pennisetum clandestinum + item-110 at level 6: text: ). The DM intake of calves, heif ... meet the net energy for lactation (NE + item-111 at level 6: text: L + item-112 at level 6: text: ) and metabolizable protein (MP) ... grated in the software INRAtion 4.07 ( + item-113 at level 6: text: https://www.inration.educagri.fr/fr/forum.php + item-114 at level 6: text: ). The nutrient intake was calcu ... collected throughout the experiments. + item-115 at level 5: table with [21x11] + item-115 at level 6: caption: Table 2 Dairy cows’ diets in different scenariosa. + item-116 at level 6: unspecified: group rich_cell_group_2_0_3 + item-117 at level 7: inline: group group + item-118 at level 8: text: DM intake, kg d + item-119 at level 8: text: -1 + item-120 at level 6: unspecified: group rich_cell_group_2_0_4 + item-121 at level 7: inline: group group + item-122 at level 8: text: Ingredients, g (kg DM) + item-123 at level 8: text: -1 + item-124 at level 6: unspecified: group rich_cell_group_2_0_11 + item-125 at level 7: inline: group group + item-126 at level 8: text: Chemical composition, g (kg DM) + item-127 at level 8: text: -1 + item-128 at level 6: unspecified: group rich_cell_group_2_0_19 + item-129 at level 7: inline: group group + item-130 at level 8: text: NE + item-131 at level 8: text: L + item-132 at level 8: text: , Mcal (kg DM) + item-133 at level 8: text: -1 + item-134 at level 6: unspecified: group rich_cell_group_2_0_20 + item-135 at level 7: inline: group group + item-136 at level 8: text: MP, g (kg DM) + item-137 at level 8: text: -1 + item-138 at level 4: section_header: GHG emissions from crop and pasture production + item-139 at level 5: inline: group group + item-140 at level 6: text: GHG emission factors used for of ... s productions were 3300 and 1500 kg CO + item-141 at level 6: text: 2 + item-142 at level 6: text: e ha + item-143 at level 6: text: -1 + item-144 at level 6: text: , respectively [32]. The DM production (kg ha + item-145 at level 6: text: -1 + item-146 at level 6: text: ) of corn silage and pastures we ... onsume 70% of pastures during grazing. + item-147 at level 5: table with [9x5] + item-147 at level 6: caption: Table 3 GHG emission factors for Off- and On-farm feed production. + item-148 at level 6: unspecified: group rich_cell_group_3_1_0 + item-149 at level 7: inline: group group + item-150 at level 8: text: DM yield (kg ha + item-151 at level 8: text: -1 + item-152 at level 8: text: ) + item-153 at level 6: unspecified: group rich_cell_group_3_3_0 + item-154 at level 7: inline: group group + item-155 at level 8: text: Unit + item-156 at level 8: text: a + item-157 at level 6: unspecified: group rich_cell_group_3_3_2 + item-158 at level 7: inline: group group + item-159 at level 8: text: kg CO + item-160 at level 8: text: 2 + item-161 at level 8: text: e (kg grain) + item-162 at level 8: text: -1 + item-163 at level 6: unspecified: group rich_cell_group_3_3_3 + item-164 at level 7: inline: group group + item-165 at level 8: text: kg CO + item-166 at level 8: text: 2 + item-167 at level 8: text: e (kg grain) + item-168 at level 8: text: -1 + item-169 at level 6: unspecified: group rich_cell_group_3_0_5 + item-170 at level 7: inline: group group + item-171 at level 8: text: Corn silage + item-172 at level 8: text: b + item-173 at level 6: unspecified: group rich_cell_group_3_3_5 + item-174 at level 7: inline: group group + item-175 at level 8: text: kg CO + item-176 at level 8: text: 2 + item-177 at level 8: text: e (kg DM) + item-178 at level 8: text: -1 + item-179 at level 6: unspecified: group rich_cell_group_3_0_6 + item-180 at level 7: inline: group group + item-181 at level 8: text: Annual ryegrass + item-182 at level 8: text: c + item-183 at level 6: unspecified: group rich_cell_group_3_3_6 + item-184 at level 7: inline: group group + item-185 at level 8: text: kg CO + item-186 at level 8: text: 2 + item-187 at level 8: text: e (kg DM) + item-188 at level 8: text: -1 + item-189 at level 6: unspecified: group rich_cell_group_3_0_7 + item-190 at level 7: inline: group group + item-191 at level 8: text: Pearl millet + item-192 at level 8: text: d + item-193 at level 6: unspecified: group rich_cell_group_3_3_7 + item-194 at level 7: inline: group group + item-195 at level 8: text: kg CO + item-196 at level 8: text: 2 + item-197 at level 8: text: e (kg DM) + item-198 at level 8: text: -1 + item-199 at level 6: unspecified: group rich_cell_group_3_0_8 + item-200 at level 7: inline: group group + item-201 at level 8: text: Kikuyu grass + item-202 at level 8: text: e + item-203 at level 6: unspecified: group rich_cell_group_3_3_8 + item-204 at level 7: inline: group group + item-205 at level 8: text: kg CO + item-206 at level 8: text: 2 + item-207 at level 8: text: e (kg DM) + item-208 at level 8: text: -1 + item-209 at level 5: inline: group group + item-210 at level 6: text: Emissions from on-farm feed prod ... ary sources were direct and indirect N + item-211 at level 6: text: 2 + item-212 at level 6: text: O-N emissions from organic and s ... tilizers and crop/pasture residues, CO + item-213 at level 6: text: 2 + item-214 at level 6: text: -C emissions from lime and urea ... well as fuel combustion. The direct N + item-215 at level 6: text: 2 + item-216 at level 6: text: O-N emission factor (kg (kg N input) + item-217 at level 6: text: -1 + item-218 at level 6: text: ) is based on a local study performed previously [37]. For indirect N + item-219 at level 6: text: 2 + item-220 at level 6: text: O-N emissions (kg N + item-221 at level 6: text: 2 + item-222 at level 6: text: O-N (kg NH + item-223 at level 6: text: 3 + item-224 at level 6: text: -N + NO + item-225 at level 6: text: x + item-226 at level 6: text: ) + item-227 at level 6: text: -1 + item-228 at level 6: text: ), as well as CO + item-229 at level 6: text: 2 + item-230 at level 6: text: -C emissions from lime + urea, d ... stures, a C sequestration of 0.57 t ha + item-231 at level 6: text: -1 + item-232 at level 6: text: was used based on a 9-year study ... red was 8.9 (no-tillage) and 14.3 L ha + item-233 at level 6: text: -1 + item-234 at level 6: text: (disking) for annual tropical an ... te pastures, respectively [40]. The CO + item-235 at level 6: text: 2 + item-236 at level 6: text: from fuel combustion was 2.7 kg CO + item-237 at level 6: text: 2 + item-238 at level 6: text: L + item-239 at level 6: text: -1 + item-240 at level 6: text: [41]. Secondary sources of emiss ... factors described by Rotz et al. [42]. + item-241 at level 5: table with [28x5] + item-241 at level 6: caption: Table 4 GHG emissions from On-farm feed production. + item-242 at level 6: unspecified: group rich_cell_group_4_0_1 + item-243 at level 7: inline: group group + item-244 at level 8: text: DM yield, kg ha + item-245 at level 8: text: -1 + item-246 at level 6: unspecified: group rich_cell_group_4_0_2 + item-247 at level 7: inline: group group + item-248 at level 8: text: Direct N + item-249 at level 8: text: 2 + item-250 at level 8: text: O emissions to air + item-251 at level 6: unspecified: group rich_cell_group_4_0_3 + item-252 at level 7: inline: group group + item-253 at level 8: text: N organic fertilizer, kg ha + item-254 at level 8: text: -1 + item-255 at level 8: text: a + item-256 at level 6: unspecified: group rich_cell_group_4_0_5 + item-257 at level 7: inline: group group + item-258 at level 8: text: N from residual DM, kg ha + item-259 at level 8: text: -1 + item-260 at level 8: text: b + item-261 at level 6: unspecified: group rich_cell_group_4_0_6 + item-262 at level 7: inline: group group + item-263 at level 8: text: Emission fator, kg N + item-264 at level 8: text: 2 + item-265 at level 8: text: O-N (kg N) + item-266 at level 8: text: -1 + item-267 at level 8: text: c + item-268 at level 6: unspecified: group rich_cell_group_4_0_7 + item-269 at level 7: inline: group group + item-270 at level 8: text: kg N + item-271 at level 8: text: 2 + item-272 at level 8: text: O ha + item-273 at level 8: text: -1 + item-274 at level 8: text: from direct emissions + item-275 at level 6: unspecified: group rich_cell_group_4_0_8 + item-276 at level 7: inline: group group + item-277 at level 8: text: Indirect N + item-278 at level 8: text: 2 + item-279 at level 8: text: O emissions to air + item-280 at level 6: unspecified: group rich_cell_group_4_0_9 + item-281 at level 7: inline: group group + item-282 at level 8: text: kg NH + item-283 at level 8: text: 3 + item-284 at level 8: text: -N+NO + item-285 at level 8: text: x + item-286 at level 8: text: -N (kg organic N) + item-287 at level 8: text: -1 + item-288 at level 8: text: b + item-289 at level 6: unspecified: group rich_cell_group_4_0_10 + item-290 at level 7: inline: group group + item-291 at level 8: text: kg NH + item-292 at level 8: text: 3 + item-293 at level 8: text: -N+NO + item-294 at level 8: text: x + item-295 at level 8: text: -N (kg synthetic N) + item-296 at level 8: text: -1 + item-297 at level 8: text: b + item-298 at level 6: unspecified: group rich_cell_group_4_0_11 + item-299 at level 7: inline: group group + item-300 at level 8: text: kg N + item-301 at level 8: text: 2 + item-302 at level 8: text: O-N (kg NH + item-303 at level 8: text: 3 + item-304 at level 8: text: -N+NO + item-305 at level 8: text: x + item-306 at level 8: text: -N) + item-307 at level 8: text: -1 + item-308 at level 8: text: b + item-309 at level 6: unspecified: group rich_cell_group_4_0_12 + item-310 at level 7: inline: group group + item-311 at level 8: text: kg N + item-312 at level 8: text: 2 + item-313 at level 8: text: O ha + item-314 at level 8: text: -1 + item-315 at level 8: text: from NH + item-316 at level 8: text: 3 + item-317 at level 8: text: +NO + item-318 at level 8: text: x + item-319 at level 8: text: volatilized + item-320 at level 6: unspecified: group rich_cell_group_4_0_13 + item-321 at level 7: inline: group group + item-322 at level 8: text: Indirect N + item-323 at level 8: text: 2 + item-324 at level 8: text: O emissions to soil + item-325 at level 6: unspecified: group rich_cell_group_4_0_14 + item-326 at level 7: inline: group group + item-327 at level 8: text: kg N losses by leaching (kg N) + item-328 at level 8: text: -1 + item-329 at level 8: text: b + item-330 at level 6: unspecified: group rich_cell_group_4_0_15 + item-331 at level 7: inline: group group + item-332 at level 8: text: kg N + item-333 at level 8: text: 2 + item-334 at level 8: text: O-N (kg N leaching) + item-335 at level 8: text: -1 + item-336 at level 6: unspecified: group rich_cell_group_4_0_16 + item-337 at level 7: inline: group group + item-338 at level 8: text: kg N + item-339 at level 8: text: 2 + item-340 at level 8: text: O ha + item-341 at level 8: text: -1 + item-342 at level 8: text: from N losses by leaching + item-343 at level 6: unspecified: group rich_cell_group_4_0_17 + item-344 at level 7: inline: group group + item-345 at level 8: text: kg N + item-346 at level 8: text: 2 + item-347 at level 8: text: O ha + item-348 at level 8: text: -1 + item-349 at level 8: text: (direct + indirect emissions) + item-350 at level 6: unspecified: group rich_cell_group_4_0_18 + item-351 at level 7: inline: group group + item-352 at level 8: text: kg CO + item-353 at level 8: text: 2 + item-354 at level 8: text: e ha + item-355 at level 8: text: -1 + item-356 at level 8: text: from N + item-357 at level 8: text: 2 + item-358 at level 8: text: 0 emissions + item-359 at level 8: text: d + item-360 at level 6: unspecified: group rich_cell_group_4_0_19 + item-361 at level 7: inline: group group + item-362 at level 8: text: kg CO + item-363 at level 8: text: 2 + item-364 at level 8: text: ha + item-365 at level 8: text: -1 + item-366 at level 8: text: from lime+urea + item-367 at level 8: text: b + item-368 at level 6: unspecified: group rich_cell_group_4_0_20 + item-369 at level 7: inline: group group + item-370 at level 8: text: kg CO + item-371 at level 8: text: 2 + item-372 at level 8: text: ha + item-373 at level 8: text: -1 + item-374 at level 8: text: from diesel combustion + item-375 at level 8: text: e + item-376 at level 6: unspecified: group rich_cell_group_4_0_21 + item-377 at level 7: inline: group group + item-378 at level 8: text: kg CO + item-379 at level 8: text: 2 + item-380 at level 8: text: e from secondary sources + item-381 at level 8: text: f + item-382 at level 6: unspecified: group rich_cell_group_4_0_22 + item-383 at level 7: inline: group group + item-384 at level 8: text: Total CO + item-385 at level 8: text: 2 + item-386 at level 8: text: e emitted, kg ha + item-387 at level 8: text: -1 + item-388 at level 6: unspecified: group rich_cell_group_4_0_23 + item-389 at level 7: inline: group group + item-390 at level 8: text: Emission factor, kg CO + item-391 at level 8: text: 2 + item-392 at level 8: text: e (kg DM) + item-393 at level 8: text: -1 + item-394 at level 8: text: g + item-395 at level 6: unspecified: group rich_cell_group_4_0_24 + item-396 at level 7: inline: group group + item-397 at level 8: text: Carbon sequestered, kg ha + item-398 at level 8: text: -1 + item-399 at level 8: text: h + item-400 at level 6: unspecified: group rich_cell_group_4_0_25 + item-401 at level 7: inline: group group + item-402 at level 8: text: Sequestered CO + item-403 at level 8: text: 2 + item-404 at level 8: text: -C, kg ha + item-405 at level 8: text: -1 + item-406 at level 6: unspecified: group rich_cell_group_4_0_26 + item-407 at level 7: inline: group group + item-408 at level 8: text: kg CO + item-409 at level 8: text: 2 + item-410 at level 8: text: e ha + item-411 at level 8: text: -1 + item-412 at level 8: text: (emitted—sequestered) + item-413 at level 6: unspecified: group rich_cell_group_4_0_27 + item-414 at level 7: inline: group group + item-415 at level 8: text: Emission factor, kg CO + item-416 at level 8: text: 2 + item-417 at level 8: text: e (kg DM) + item-418 at level 8: text: -1 + item-419 at level 8: text: i + item-420 at level 3: section_header: Animal husbandry + item-421 at level 4: inline: group group + item-422 at level 5: text: The CH + item-423 at level 5: text: 4 + item-424 at level 5: text: emissions from enteric fermentation intensity (g (kg ECM) + item-425 at level 5: text: -1 + item-426 at level 5: text: ) was a function of estimated CH + item-427 at level 5: text: 4 + item-428 at level 5: text: yield (g (kg DM intake) + item-429 at level 5: text: -1 + item-430 at level 5: text: ), actual DM intake and ECM. The enteric CH + item-431 at level 5: text: 4 + item-432 at level 5: text: yield was estimated as a functio ... proposed by Niu et al. [43], where: CH + item-433 at level 5: text: 4 + item-434 at level 5: text: yield (g (kg DM intake) item-435 at level 5: text: -1 - item-436 at level 5: text: [46]) is much lower than that in a LCA study conducted in US (0.73 kg CO - item-437 at level 5: text: 2 - item-438 at level 5: text: e kWh - item-439 at level 5: text: -1 - item-440 at level 5: text: [42]). This apparent discrepancy ... has an emission factor of 0.074 kg CO - item-441 at level 5: text: 2 - item-442 at level 5: text: e kWh - item-443 at level 5: text: -1 - item-444 at level 5: text: against 0.382 and 0.926 kg CO - item-445 at level 5: text: 2 - item-446 at level 5: text: e kWh - item-447 at level 5: text: -1 - item-448 at level 5: text: produced by natural gas and hard coal, respectively [46]. - item-449 at level 3: section_header: Assumptions and limitations - item-450 at level 4: inline: group group - item-451 at level 5: text: The milk production and composit ... sion factors for direct and indirect N - item-452 at level 5: text: 2 - item-453 at level 5: text: O emissions from urine and dung ... sary to reduce the uncertainty. The CO - item-454 at level 5: text: 2 - item-455 at level 5: text: emitted from lime and urea appli ... ions as a function of soil management. - item-456 at level 3: section_header: Further considerations - item-457 at level 4: inline: group group - item-458 at level 5: text: The potential for using pasture ... reduced the C footprint by 0.12 kg CO - item-459 at level 5: text: 2 - item-460 at level 5: text: e (kg ECM) - item-461 at level 5: text: -1 - item-462 at level 5: text: , whereas an increase from 10,00 ... ced the C footprint by only 0.06 kg CO - item-463 at level 5: text: 2 - item-464 at level 5: text: e (kg ECM) - item-465 at level 5: text: -1 - item-466 at level 5: text: . Hence, the impact of increasin ... C footprint may increase by 0.03 kg CO + item-436 at level 5: text: ) = 13.8 + 0.185 × NDF (% DM intake). + item-437 at level 3: section_header: Manure from confined cows and urine and dung from grazing animals + item-438 at level 4: inline: group group + item-439 at level 5: text: The CH + item-440 at level 5: text: 4 + item-441 at level 5: text: emission from manure (kg (kg ECM) + item-442 at level 5: text: -1 + item-443 at level 5: text: ) was a function of daily CH + item-444 at level 5: text: 4 + item-445 at level 5: text: emission from manure (kg cow + item-446 at level 5: text: -1 + item-447 at level 5: text: ) and daily ECM (kg cow + item-448 at level 5: text: -1 + item-449 at level 5: text: ). The daily CH + item-450 at level 5: text: 4 + item-451 at level 5: text: emission from manure was estimat ... olatile solid (VS) excreted (kg DM cow + item-452 at level 5: text: -1 + item-453 at level 5: text: ) in manure. The daily VS was es ... n an organic matter (OM) basis (kg day + item-454 at level 5: text: -1 + item-455 at level 5: text: ), NDOMI = non-digestible OM intake (kg day + item-456 at level 5: text: -1 + item-457 at level 5: text: ): (1- OM digestibility) × OM in ... .04), GE = gross energy intake (MJ day + item-458 at level 5: text: -1 + item-459 at level 5: text: ), OM = organic matter (g), 18.4 ... tor for dietary GE per kg of DM (MJ kg + item-460 at level 5: text: -1 + item-461 at level 5: text: ). + item-462 at level 4: text: The OM digestibility was estimat ... h were 31%, 26% and 46%, respectively. + item-463 at level 4: inline: group group + item-464 at level 5: text: The N + item-465 at level 5: text: 2 + item-466 at level 5: text: O-N emissions from urine and fec ... ations 10 and 12, respectively). The N item-467 at level 5: text: 2 - item-468 at level 5: text: e (kg ECM) - item-469 at level 5: text: -1 - item-470 at level 5: text: in subclinical ketosis [71] and by 0.02 kg CO + item-468 at level 5: text: O emissions from stored manure a ... alculated based on the conversion of N + item-469 at level 5: text: 2 + item-470 at level 5: text: O-N emissions to N item-471 at level 5: text: 2 - item-472 at level 5: text: e (kg ECM) - item-473 at level 5: text: -1 - item-474 at level 5: text: in case of foot lesions [72]. - item-475 at level 4: inline: group group - item-476 at level 5: text: Grazing lands may also improve b ... n subtropical areas by 0.5 to 1.5 t ha - item-477 at level 5: text: -1 - item-478 at level 5: text: [75]. If 50% of tilled areas were under perennial grasslands, 1.0 t C ha + item-472 at level 5: text: O emissions, where N + item-473 at level 5: text: 2 + item-474 at level 5: text: O emissions = N + item-475 at level 5: text: 2 + item-476 at level 5: text: O-N emissions × 44/28. The emission factors were 0.002 kg N + item-477 at level 5: text: 2 + item-478 at level 5: text: O-N (kg N) item-479 at level 5: text: -1 - item-480 at level 5: text: would be sequestered, further re ... e C footprint by 0.015 and 0.025 kg CO + item-480 at level 5: text: stored in a pit below animal confinements, and 0.02 kg N item-481 at level 5: text: 2 - item-482 at level 5: text: e (kg ECM) + item-482 at level 5: text: O-N (kg of urine and dung) item-483 at level 5: text: -1 - item-484 at level 5: text: for the scenarios using 75 and 5 ... emissions would be 0.03 and 0.05 kg CO + item-484 at level 5: text: deposited on pasture [38]. The indirect N item-485 at level 5: text: 2 - item-486 at level 5: text: e (kg ECM) - item-487 at level 5: text: -1 - item-488 at level 5: text: for 75 and 50% TMR, respectively ... C storage, so that net exchange of CO - item-489 at level 5: text: 2 - item-490 at level 5: text: would be negligible [76]. - item-491 at level 2: section_header: Conclusions - item-492 at level 3: inline: group group - item-493 at level 4: text: This study assessed the C footpr ... attributable to the evidence of low N - item-494 at level 4: text: 2 - item-495 at level 4: text: O emissions from urine and dung ... ical areas. Even though the enteric CH - item-496 at level 4: text: 4 - item-497 at level 4: text: intensity was the largest source of CO - item-498 at level 4: text: 2 - item-499 at level 4: text: e emissions, it did not change b ... on with or without access to pastures. - item-500 at level 2: section_header: Acknowledgments - item-501 at level 3: text: Thanks to Anna Naranjo for helpf ... of the herd considered in this study. - item-502 at level 2: section_header: References - item-503 at level 3: list: group list - item-504 at level 4: list_item: IPCC. Climate Change and Land. Chapter 5: Food Security. 2019. - item-505 at level 4: list_item: HerreroM, HendersonB, HavlíkP, T ... 2016;6: 452–461. 10.1038/nclimate2925 - item-506 at level 4: list_item: Rivera-FerreMG, López-i-GelatsF, ... hang. 2016;7: 869–892. 10.1002/wcc.421 - item-507 at level 4: list_item: van ZantenHHE, MollenhorstH, Klo ... 21: 747–758. 10.1007/s11367-015-0944-1 - item-508 at level 4: list_item: HristovAN, OhJ, FirkinsL, Dijkst ... 5–5069. 10.2527/jas.2013-6583 24045497 - item-509 at level 4: list_item: HristovAN, OttT, TricaricoJ, Rot ... 5–5113. 10.2527/jas.2013-6585 24045470 - item-510 at level 4: list_item: MontesF, MeinenR, DellC, RotzA, ... 0–5094. 10.2527/jas.2013-6584 24045493 - item-511 at level 4: list_item: LedgardSF, WeiS, WangX, Falconer ... : 155–163. 10.1016/j.agwat.2018.10.009 - item-512 at level 4: list_item: O’BrienD, ShallooL, PattonJ, Buc ... 107: 33–46. 10.1016/j.agsy.2011.11.004 - item-513 at level 4: list_item: SalouT, Le MouëlC, van der WerfH ... od. 2017 10.1016/j.jclepro.2016.05.019 - item-514 at level 4: list_item: LizarraldeC, PicassoV, RotzCA, C ... gric Res. 2014;3: 1 10.5539/sar.v3n2p1 - item-515 at level 4: list_item: ClarkCEF, KaurR, MillapanLO, Gol ... –5465. 10.3168/jds.2017-13388 29550132 - item-516 at level 4: list_item: Food and Agriculture Organization. FAOSTAT. 2017. - item-517 at level 4: list_item: VogelerI, MackayA, VibartR, Rend ... .1016/j.scitotenv.2016.05.006 27203517 - item-518 at level 4: list_item: WilkinsonJM, LeeMRF, RiveroMJ, C ... 0;75: 1–17. 10.1111/gfs.12458 32109974 - item-519 at level 4: list_item: WalesWJ, MarettLC, GreenwoodJS, ... i. 2013;53: 1167–1178. 10.1071/AN13207 - item-520 at level 4: list_item: BargoF, MullerLD, DelahoyJE, Cas ... 168/jds.S0022-0302(02)74381-6 12487461 - item-521 at level 4: list_item: VibartRE, FellnerV, BurnsJC, Hun ... 80. 10.1017/S0022029908003361 18701000 - item-522 at level 4: list_item: MendozaA, CajarvilleC, RepettoJL ... –1944. 10.3168/jds.2015-10257 26778319 - item-523 at level 4: list_item: NRC. Nutrient Requirements of Da ... gton DC: National Academy Press; 2001. - item-524 at level 4: list_item: INRA. INRA Feeding System for Ru ... shiers; 2018 10.3920/978-90-8686-872-8 - item-525 at level 4: list_item: LorenzH, ReinschT, HessS, TaubeF ... 161–170. 10.1016/j.jclepro.2018.11.113 - item-526 at level 4: list_item: ISO 14044. INTERNATIONAL STANDAR ... rements and guidelines. 2006;2006: 46. - item-527 at level 4: list_item: ISO 14040. The International Sta ... ;2006: 1–28. 10.1136/bmj.332.7550.1107 - item-528 at level 4: list_item: FAO. Environmental Performance o ... nerships/leap/resources/guidelines/en/ - item-529 at level 4: list_item: CivieroM, Ribeiro-FilhoHMN, Scha ... nce,. Foz do Iguaçu; 2019 pp. 141–141. - item-530 at level 4: list_item: IPCC—Intergovernmental Panel on ... /2018/05/SYR_AR5_FINAL_full_wcover.pdf - item-531 at level 4: list_item: INRA. Alimentation des bovins, o ... Inra 2007. 4th ed. INRA, editor. 2007. - item-532 at level 4: list_item: DelagardeR, FaverdinP, BaratteC, ... 5–60. 10.1111/j.1365-2494.2010.00770.x - item-533 at level 4: list_item: MaBL, LiangBC, BiswasDK, Morriso ... 2;94: 15–31. 10.1007/s10705-012-9522-0 - item-534 at level 4: list_item: RauccciGS, MoreiraCS, AlvesPS, M ... State. J Clean Prod. 2015;96: 418–425. - item-535 at level 4: list_item: CamargoGGT, RyanMR, RichardTL. E ... 3;63: 263–273. 10.1525/bio.2013.63.4.6 - item-536 at level 4: list_item: da SilvaMSJ, JobimCC, PoppiEC, T ... 3–313. 10.1590/S1806-92902015000900001 - item-537 at level 4: list_item: Duchini PGPGGuzatti GCGC, Ribeir ... Sci. 2016;67: 574–581. 10.1071/CP15170 - item-538 at level 4: list_item: ScaravelliLFB, PereiraLET, Olivo ... teiras. Cienc Rural. 2007;37: 841–846. - item-539 at level 4: list_item: SbrissiaAF, DuchiniPG, ZaniniGD, ... : 945–954. 10.2135/cropsci2017.07.0447 - item-540 at level 4: list_item: AlmeidaJGR, Dall-OrsolettaAC, Oz ... 12. 10.1017/S1751731119003057 31907089 - item-541 at level 4: list_item: Intergovernamental Panel on Clim ... Global Environmental Strategies; 2006. - item-542 at level 4: list_item: RamalhoB, DieckowJ, BarthG, Simo ... il Sci. 2020; 1–14. 10.1111/ejss.12933 - item-543 at level 4: list_item: FernandesHC, da SilveiraJCM, Rin ... –1587. 10.1590/s1413-70542008000500034 - item-544 at level 4: list_item: Wang M Q. GREET 1.8a Spreadsheet ... transportation.anl.gov/software/GREET/ - item-545 at level 4: list_item: RotzCAA, MontesF, ChianeseDS, Ch ... 6–1282. 10.3168/jds.2009-2162 20172247 - item-546 at level 4: list_item: NiuM, KebreabE, HristovAN, OhJ, ... 3368–3389. 10.1111/gcb.14094 29450980 - item-547 at level 4: list_item: EugèneM, SauvantD, NozièreP, Via ... 10.1016/j.jenvman.2018.10.086 30602259 - item-548 at level 4: list_item: ReedKF, MoraesLE, CasperDP, Kebr ... 5–3035. 10.3168/jds.2014-8397 25747829 - item-549 at level 4: list_item: BarrosMV, PiekarskiCM, De Franci ... . Energies. 2018;11 10.3390/en11061412 - item-550 at level 4: list_item: LudingtonD, JohnsonE. Dairy Farm ... York State Energy Res Dev Auth. 2003. - item-551 at level 4: list_item: ThomaG, JollietO, WangY. A bioph ... 2013;31 10.1016/j.idairyj.2012.08.012 - item-552 at level 4: list_item: NaranjoA, JohnsonA, RossowH. Gre ... . 2020 10.3168/jds.2019-16576 32037166 - item-553 at level 4: list_item: JayasundaraS, WordenD, WeersinkA ... 18–1028. 10.1016/j.jclepro.2019.04.013 - item-554 at level 4: list_item: WilliamsSRO, FisherPD, Berrisfor ... 4;19: 69–78. 10.1007/s11367-013-0619-8 - item-555 at level 4: list_item: GollnowS, LundieS, MooreAD, McLa ... : 31–38. 10.1016/j.idairyj.2014.02.005 - item-556 at level 4: list_item: O’BrienD, CapperJL, GarnsworthyP ... i. 2014 10.3168/jds.2013-7174 24440256 - item-557 at level 4: list_item: ChobtangJ, McLarenSJ, LedgardSF, ... 2017;21: 1139–1152. 10.1111/jiec.12484 - item-558 at level 4: list_item: GargMR, PhondbaBT, SherasiaPL, M ... Sci. 2016;56: 423–436. 10.1071/AN15464 - item-559 at level 4: list_item: de LéisCM, CherubiniE, RuviaroCF ... 5;20: 46–60. 10.1007/s11367-014-0813-3 - item-560 at level 4: list_item: O’BrienD, GeogheganA, McNamaraK, ... Sci. 2016;56: 495–500. 10.1071/AN15490 - item-561 at level 4: list_item: O’BrienD, BrennanP, HumphreysJ, ... : 1469–1481. 10.1007/s11367-014-0755-9 - item-562 at level 4: list_item: BaekCY, LeeKM, ParkKH. Quantific ... : 50–60. 10.1016/j.jclepro.2014.02.010 - item-563 at level 4: list_item: Dall-OrsolettaAC, AlmeidaJGR, Ca ... –4383. 10.3168/jds.2015-10396 27016830 - item-564 at level 4: list_item: Dall-OrsolettaAC, OziemblowskiMM ... 5–73. 10.1016/j.anifeedsci.2019.05.009 - item-565 at level 4: list_item: NiuM, AppuhamyJADRN, LeytemAB, D ... Sci. 2016;56: 312–321. 10.1071/AN15498 - item-566 at level 4: list_item: WaghornGC, LawN, BryantM, Pachec ... i. 2019;59: 1261–1270. 10.1071/AN18018 - item-567 at level 4: list_item: DickhoeferU, GlowackiS, GómezCA, ... 109–118. 10.1016/j.livsci.2018.08.004 - item-568 at level 4: list_item: SchwabCG, BroderickGA. A 100-Yea ... 10112. 10.3168/jds.2017-13320 29153157 - item-569 at level 4: list_item: SordiA, DieckowJ, BayerC, Alburq ... 90: 94–103. 10.1016/j.agee.2013.09.004 - item-570 at level 4: list_item: SimonPL, DieckowJ, de KleinCAM, ... 267: 74–82. 10.1016/j.agee.2018.08.013 - item-571 at level 4: list_item: WangX, LedgardS, LuoJ, GuoY, Zha ... .1016/j.scitotenv.2017.12.259 29291563 - item-572 at level 4: list_item: PirloG, LolliS. Environmental im ... 962–971. 10.1016/j.jclepro.2018.11.070 - item-573 at level 4: list_item: HerzogA, WincklerC, ZollitschW. ... 7: 174–187. 10.1016/j.agee.2018.07.029 - item-574 at level 4: list_item: MostertPF, van MiddelaarCE, Bokk ... od. 2018 10.1016/j.jclepro.2017.10.019 - item-575 at level 4: list_item: MostertPF, van MiddelaarCE, de B ... 7: 206–212. 10.1016/j.agsy.2018.09.006 - item-576 at level 4: list_item: FoleyJA, RamankuttyN, BraumanKA, ... 337–342. 10.1038/nature10452 21993620 - item-577 at level 4: list_item: LalR. Soil Carbon Sequestration ... 1627. 10.1126/science.1097396 15192216 - item-578 at level 4: list_item: BoddeyRM, JantaliaCP, ConceiçaoP ... –795. 10.1111/j.1365-2486.2009.02020.x - item-579 at level 4: list_item: McConkeyB, AngersD, BenthamM, Bo ... the LULUCF sector for NIR 2014. 2014. - item-580 at level 1: caption: Fig 1 Overview of the milk produ ... stem boundary considered in the study. - item-581 at level 1: caption: Table 1 Descriptive characteristics of the herd. - item-582 at level 1: caption: Table 2 Dairy cows’ diets in different scenariosa. - item-583 at level 1: caption: Table 3 GHG emission factors for Off- and On-farm feed production. - item-584 at level 1: caption: Table 4 GHG emissions from On-farm feed production. - item-585 at level 1: caption: Table 5 Factors for major resource inputs in farm management. - item-586 at level 1: caption: Fig 2 Overall greenhouse gas emi ... lectricity = 0.205 kg CO2e kWh-1 [46]. - item-587 at level 1: caption: Fig 3 Sensitivity of the C footp ... lectricity = 0.205 kg CO2e kWh-1 [46]. - item-588 at level 1: caption: Fig 4 Greenhouse gas emissions ( ... uestered CO2-C from perennial pasture. \ No newline at end of file + item-486 at level 5: text: O emissions from storage manure ... using the IPCC [38] emission factors. + item-487 at level 3: section_header: Farm management + item-488 at level 4: text: Emissions due to farm management ... crop and pasture production’ section. + item-489 at level 4: table with [12x4] + item-489 at level 5: caption: Table 5 Factors for major resource inputs in farm management. + item-490 at level 5: unspecified: group rich_cell_group_5_2_0 + item-491 at level 6: inline: group group + item-492 at level 7: text: Unit + item-493 at level 7: text: a + item-494 at level 5: unspecified: group rich_cell_group_5_2_1 + item-495 at level 6: inline: group group + item-496 at level 7: text: kg CO + item-497 at level 7: text: 2 + item-498 at level 7: text: e L + item-499 at level 7: text: -1 + item-500 at level 5: unspecified: group rich_cell_group_5_2_2 + item-501 at level 6: inline: group group + item-502 at level 7: text: kg CO + item-503 at level 7: text: 2 + item-504 at level 7: text: e L + item-505 at level 7: text: -1 + item-506 at level 5: unspecified: group rich_cell_group_5_0_3 + item-507 at level 6: inline: group group + item-508 at level 7: text: Production of electricity + item-509 at level 7: text: b + item-510 at level 5: unspecified: group rich_cell_group_5_2_3 + item-511 at level 6: inline: group group + item-512 at level 7: text: kg CO + item-513 at level 7: text: 2 + item-514 at level 7: text: e kWh + item-515 at level 7: text: -1 + item-516 at level 5: unspecified: group rich_cell_group_5_0_4 + item-517 at level 6: inline: group group + item-518 at level 7: text: Production of electricity (alternative) + item-519 at level 7: text: c + item-520 at level 5: unspecified: group rich_cell_group_5_2_4 + item-521 at level 6: inline: group group + item-522 at level 7: text: kg CO + item-523 at level 7: text: 2 + item-524 at level 7: text: e kWh + item-525 at level 7: text: -1 + item-526 at level 5: unspecified: group rich_cell_group_5_2_5 + item-527 at level 6: inline: group group + item-528 at level 7: text: kg CO + item-529 at level 7: text: 2 + item-530 at level 7: text: e (kg mm) + item-531 at level 7: text: -1 + item-532 at level 5: unspecified: group rich_cell_group_5_2_7 + item-533 at level 6: inline: group group + item-534 at level 7: text: L diesel tonne + item-535 at level 7: text: -1 + item-536 at level 5: unspecified: group rich_cell_group_5_2_8 + item-537 at level 6: inline: group group + item-538 at level 7: text: kg mm kg + item-539 at level 7: text: -1 + item-540 at level 5: unspecified: group rich_cell_group_5_2_10 + item-541 at level 6: inline: group group + item-542 at level 7: text: kWh (kg milk) + item-543 at level 7: text: -1 + item-544 at level 5: unspecified: group rich_cell_group_5_0_11 + item-545 at level 6: inline: group group + item-546 at level 7: text: Electricity for lighting + item-547 at level 7: text: d + item-548 at level 5: unspecified: group rich_cell_group_5_2_11 + item-549 at level 6: inline: group group + item-550 at level 7: text: kWh cow + item-551 at level 7: text: -1 + item-552 at level 4: inline: group group + item-553 at level 5: text: The amount of fuel use for manur ... quired for manure handling (L diesel t + item-554 at level 5: text: -1 + item-555 at level 5: text: ) [42]. The amount of manure was estimated from OM excretions (kg cow + item-556 at level 5: text: -1 + item-557 at level 5: text: ), assuming that the manure has ... me that animals stayed on confinement. + item-558 at level 4: inline: group group + item-559 at level 5: text: The emissions from fuel were est ... uired for manure handling (L) × (kg CO + item-560 at level 5: text: 2 + item-561 at level 5: text: e L + item-562 at level 5: text: -1 + item-563 at level 5: text: ) [41]. The secondary emissions ... roduction and transport of fuel (kg CO + item-564 at level 5: text: 2 + item-565 at level 5: text: e L + item-566 at level 5: text: -1 + item-567 at level 5: text: ) [41]. Emissions from manufactu ... w (t) × (kg machinery mass (kg manure) + item-568 at level 5: text: -1 + item-569 at level 5: text: × 10 + item-570 at level 5: text: −3 + item-571 at level 5: text: ) [42] × kg CO + item-572 at level 5: text: 2 + item-573 at level 5: text: e (kg machinery mass) + item-574 at level 5: text: -1 + item-575 at level 5: text: [42]. + item-576 at level 4: inline: group group + item-577 at level 5: text: Emissions from electricity for m ... ated using two emission factors (kg CO + item-578 at level 5: text: 2 + item-579 at level 5: text: kWh + item-580 at level 5: text: -1 + item-581 at level 5: text: ). The first one is based on Uni ... ivities is 0.06 kWh (kg milk produced) + item-582 at level 5: text: -1 + item-583 at level 5: text: [47]. The annual electricity use for lighting was 75 kWh cow + item-584 at level 5: text: -1 + item-585 at level 5: text: , which is the value considered ... ws in naturally ventilated barns [47]. + item-586 at level 3: section_header: Co-product allocation + item-587 at level 4: inline: group group + item-588 at level 5: text: The C footprint for milk produce ... ibed by Thoma et al. [48]. Briefly, AR + item-589 at level 5: text: milk + item-590 at level 5: text: = 1–6.04 × BMR, where + item-591 at level 5: text: : + item-592 at level 5: text: AR + item-593 at level 5: text: milk + item-594 at level 5: text: is the allocation ratio for milk ... during cow`s entire life (kg). The AR + item-595 at level 5: text: milk + item-596 at level 5: text: were 0.854 and 0.849 for TMR and ... asture scenarios, respectively. The AR + item-597 at level 5: text: milk + item-598 at level 5: text: was applied to the whole emissio ... directly assigned to milk production. + item-599 at level 3: section_header: Sensitivity analysis + item-600 at level 4: text: A sensitivity index was calculat ... ses a similar change in the footprint. + item-601 at level 2: section_header: Results and discussion + item-602 at level 3: text: The study has assessed the impac ... , feed production and electricity use. + item-603 at level 3: section_header: Greenhouse gas emissions + item-604 at level 4: inline: group group + item-605 at level 5: text: Depending on emission factors us ... 2A and 2B) or decreased by 0.04 kg CO + item-606 at level 5: text: 2 + item-607 at level 5: text: e (kg ECM) + item-608 at level 5: text: -1 + item-609 at level 5: text: (Fig 2C and 2D) in scenarios that included pastures compared to + item-610 at level 5: text: ad libitum + item-611 at level 5: text: TMR intake. Due to differences i ... values ranged from 0.92 to 1.04 kg CO + item-612 at level 5: text: 2 + item-613 at level 5: text: e (kg ECM) + item-614 at level 5: text: -1 + item-615 at level 5: text: for dairy cows receiving TMR exclusively, and from 0.88 to 1.04 kg CO + item-616 at level 5: text: 2 + item-617 at level 5: text: e (kg ECM) + item-618 at level 5: text: -1 + item-619 at level 5: text: for cows with access to pasture. ... ocal emission factors for estimating N + item-620 at level 5: text: 2 + item-621 at level 5: text: O-N emissions [37], manure emiss ... more than 5% of overall GHG emissions. + item-622 at level 4: picture + item-622 at level 5: caption: Fig 2 Overall greenhouse gas emissions in dairy cattle systems under various scenarios. TMR = ad libitum TMR intake, 75TMR = 75% of ad libitum TMR intake with access to pasture, 50TMR = 50% of ad libitum TMR intake with access to pasture. (a) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.73 kg CO2e kWh-1 [41]. (b) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]; (c) N2O emission factors for urine and dung from local data [37], feed production EF from Table 4 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. (d) N2O emission factors for urine and dung from local data [37], feed production emission factors from Table 4 accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. + item-623 at level 4: inline: group group + item-624 at level 5: text: Considering IPCC emission factors for N + item-625 at level 5: text: 2 + item-626 at level 5: text: O emissions from urine and dung ... otprint ranged from 0.99 to 1.04 kg CO + item-627 at level 5: text: 2 + item-628 at level 5: text: e (kg ECM) + item-629 at level 5: text: -1 + item-630 at level 5: text: , and was close to those reporte ... , which ranged from 0.98 to 1.16 kg CO + item-631 at level 5: text: 2 + item-632 at level 5: text: e (kg ECM) + item-633 at level 5: text: -1 + item-634 at level 5: text: . When local emission factors for N + item-635 at level 5: text: 2 + item-636 at level 5: text: O emissions from urine and dung ... without accounting for sequestered CO + item-637 at level 5: text: 2 + item-638 at level 5: text: -C from perennial pasture—0.91 kg CO + item-639 at level 5: text: 2 + item-640 at level 5: text: e (kg ECM) + item-641 at level 5: text: -1 + item-642 at level 5: text: —was lower than the range of val ... , which ranged from 0.52 to 0.89 kg CO + item-643 at level 5: text: 2 + item-644 at level 5: text: e (kg ECM) + item-645 at level 5: text: -1 + item-646 at level 5: text: . Regardless of which emission f ... nt, which ranged from 1.4 to 2.3 kg CO + item-647 at level 5: text: 2 + item-648 at level 5: text: e (kg ECM) + item-649 at level 5: text: -1 + item-650 at level 5: text: [8,55]. Thus, even though differ ... e emissions estimation, sequestered CO + item-651 at level 5: text: 2 + item-652 at level 5: text: -C, etc.), herd productivity and ... the C footprint of the dairy systems. + item-653 at level 4: inline: group group + item-654 at level 5: text: The similarity of C footprint be ... served that an increase of 1000 kg cow + item-655 at level 5: text: -1 + item-656 at level 5: text: (5000 to 6000 kg ECM) reduced the C footprint by 0.12 kg CO + item-657 at level 5: text: 2 + item-658 at level 5: text: e (kg ECM) + item-659 at level 5: text: -1 + item-660 at level 5: text: , which may explain an apparent ... milk production of around 7000 kg cow + item-661 at level 5: text: -1 + item-662 at level 5: text: . Experimental data showed a red ... of TMR was replaced by pasture access. + item-663 at level 4: inline: group group + item-664 at level 5: text: The lower C footprint in scenari ... emission factors [37] were used for N + item-665 at level 5: text: 2 + item-666 at level 5: text: O emissions from urine and dung ... enarios including pastures compared to + item-667 at level 5: text: ad libitum + item-668 at level 5: text: TMR intake. Whereas the IPCC [38] considers an emission of 0.02 kg N + item-669 at level 5: text: 2 + item-670 at level 5: text: O-N (kg N) + item-671 at level 5: text: -1 + item-672 at level 5: text: for urine and dung from grazing ... five times lower, averaging 0.004 kg N + item-673 at level 5: text: 2 + item-674 at level 5: text: O-N kg + item-675 at level 5: text: -1 + item-676 at level 5: text: [37]. + item-677 at level 3: section_header: Methane emissions + item-678 at level 4: inline: group group + item-679 at level 5: text: The enteric CH + item-680 at level 5: text: 4 + item-681 at level 5: text: intensity was similar between di ... Fig 3). The large effect of enteric CH + item-682 at level 5: text: 4 + item-683 at level 5: text: emissions on the whole C footpri ... cted, because the impact of enteric CH + item-684 at level 5: text: 4 + item-685 at level 5: text: on GHG emissions of milk product ... o range from 44 to 60% of the total CO + item-686 at level 5: text: 2 + item-687 at level 5: text: e [50,52,57,58]. However, emissi ... trate feeds are greater than 0.7 kg CO + item-688 at level 5: text: 2 + item-689 at level 5: text: e kg + item-690 at level 5: text: -1 + item-691 at level 5: text: [59], which did not happen in this study. + item-692 at level 4: picture + item-692 at level 5: caption: Fig 3 Sensitivity of the C footprint. Sensitivity index = percentage change in C footprint for a 10% change in the given emission source divided by 10% of. (a) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3, production of electricity = 0.73 kg CO2e kWh-1 [41]. (b) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3, production of electricity = 0.205 kg CO2e kWh-1 [46]; (c) N2O emission factors for urine and dung from local data [37], feed production EF from Table 4 without accounting sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. (d) N2O emission factors for urine and dung from local data [37], feed production emission factors from Table 4 accounting sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. + item-693 at level 4: inline: group group + item-694 at level 5: text: The lack of difference in enteric CH + item-695 at level 5: text: 4 + item-696 at level 5: text: emissions in different systems c ... nual temperate pastures (495 g (kg DM) + item-697 at level 5: text: -1 + item-698 at level 5: text: ) compared to corn silage (550 g (kg DM) + item-699 at level 5: text: -1 + item-700 at level 5: text: ). Hence, an expected, increase ... have shown that the actual enteric CH + item-701 at level 5: text: 4 + item-702 at level 5: text: emissions may decrease with incl ... ybean meal [60] or increase enteric CH + item-703 at level 5: text: 4 + item-704 at level 5: text: emissions when dairy cows grazin ... silage [61]. Additionally, enteric CH + item-705 at level 5: text: 4 + item-706 at level 5: text: emissions did not differ between ... same scenarios as in this study [26]. + item-707 at level 3: section_header: Emissions from excreta and feed production + item-708 at level 4: inline: group group + item-709 at level 5: text: Using IPCC emission factors for N + item-710 at level 5: text: 2 + item-711 at level 5: text: O emissions from urine and dung [38] and those from Table 3, CH + item-712 at level 5: text: 4 + item-713 at level 5: text: emissions from manure decreased 0.07 kg CO + item-714 at level 5: text: 2 + item-715 at level 5: text: e (kg ECM) + item-716 at level 5: text: -1 + item-717 at level 5: text: , but N + item-718 at level 5: text: 2 + item-719 at level 5: text: O emissions from manure increased 0.09 kg CO + item-720 at level 5: text: 2 + item-721 at level 5: text: e (kg ECM) + item-722 at level 5: text: -1 + item-723 at level 5: text: , as TMR intake was restricted to 50% + item-724 at level 5: text: ad libitum + item-725 at level 5: text: (Fig 4A). Emissions for pastures increased by 0.06 kg CO + item-726 at level 5: text: 2 + item-727 at level 5: text: e (kg ECM) + item-728 at level 5: text: -1 + item-729 at level 5: text: , whereas emissions for producin ... nd corn silage decreased by 0.09 kg CO + item-730 at level 5: text: 2 + item-731 at level 5: text: e (kg ECM) + item-732 at level 5: text: -1 + item-733 at level 5: text: , as TMR intake decreased (Fig 4 ... ctating dairy cow diets. The greater N + item-734 at level 5: text: 2 + item-735 at level 5: text: O-N emissions from manure with pasture was a consequence of higher N + item-736 at level 5: text: 2 + item-737 at level 5: text: O-N emissions due to greater CP ... g CP content from 185 to 152 g (kg DM) + item-738 at level 5: text: -1 + item-739 at level 5: text: , N intake decreased by 20% and ... g dairy cows ranged from 150 g (kg DM) + item-740 at level 5: text: -1 + item-741 at level 5: text: on TMR system to 198 g (kg DM) + item-742 at level 5: text: -1 + item-743 at level 5: text: on 50% TMR with pasture. Additio ... may not be captured by microbes [65]. + item-744 at level 4: picture + item-744 at level 5: caption: Fig 4 Greenhouse gas emissions (GHG) from manure and feed production in dairy cattle systems. TMR = ad libitum TMR intake, 75TMR = 75% of ad libitum TMR intake with access to pasture, 50TMR = 50% of ad libitum TMR intake with access to pasture. (a) N2O emission factors for urine and dung from IPCC [38]. (b) Feed production emission factors from Table 3. (c) N2O emission factors for urine and dung from local data [37]. (d) Feed production emission factors from Table 4 accounting sequestered CO2-C from perennial pasture. + item-745 at level 4: inline: group group + item-746 at level 5: text: Using local emission factors for N + item-747 at level 5: text: 2 + item-748 at level 5: text: O emissions from urine and dung ... d those from Table 4, reductions in CH + item-749 at level 5: text: 4 + item-750 at level 5: text: emissions from stocked manure, w ... iets, did not offset by increases in N + item-751 at level 5: text: 2 + item-752 at level 5: text: O emissions from excreta (Fig 4C ... much lower emission factors used for N + item-753 at level 5: text: 2 + item-754 at level 5: text: O emissions from urine and dung. ... be revised for the subtropical region. + item-755 at level 4: text: Emissions for feed production de ... act, particularly in confinements [9]. + item-756 at level 3: section_header: Farm management + item-757 at level 4: text: The lower impact of emissions fr ... greater than 5% of total C footprint. + item-758 at level 4: inline: group group + item-759 at level 5: text: Emissions from farm management d ... or electricity generation (0.205 kg CO + item-760 at level 5: text: 2 + item-761 at level 5: text: e kWh + item-762 at level 5: text: -1 + item-763 at level 5: text: [46]) is much lower than that in a LCA study conducted in US (0.73 kg CO + item-764 at level 5: text: 2 + item-765 at level 5: text: e kWh + item-766 at level 5: text: -1 + item-767 at level 5: text: [42]). This apparent discrepancy ... has an emission factor of 0.074 kg CO + item-768 at level 5: text: 2 + item-769 at level 5: text: e kWh + item-770 at level 5: text: -1 + item-771 at level 5: text: against 0.382 and 0.926 kg CO + item-772 at level 5: text: 2 + item-773 at level 5: text: e kWh + item-774 at level 5: text: -1 + item-775 at level 5: text: produced by natural gas and hard coal, respectively [46]. + item-776 at level 3: section_header: Assumptions and limitations + item-777 at level 4: inline: group group + item-778 at level 5: text: The milk production and composit ... sion factors for direct and indirect N + item-779 at level 5: text: 2 + item-780 at level 5: text: O emissions from urine and dung ... sary to reduce the uncertainty. The CO + item-781 at level 5: text: 2 + item-782 at level 5: text: emitted from lime and urea appli ... ions as a function of soil management. + item-783 at level 3: section_header: Further considerations + item-784 at level 4: inline: group group + item-785 at level 5: text: The potential for using pasture ... reduced the C footprint by 0.12 kg CO + item-786 at level 5: text: 2 + item-787 at level 5: text: e (kg ECM) + item-788 at level 5: text: -1 + item-789 at level 5: text: , whereas an increase from 10,00 ... ced the C footprint by only 0.06 kg CO + item-790 at level 5: text: 2 + item-791 at level 5: text: e (kg ECM) + item-792 at level 5: text: -1 + item-793 at level 5: text: . Hence, the impact of increasin ... C footprint may increase by 0.03 kg CO + item-794 at level 5: text: 2 + item-795 at level 5: text: e (kg ECM) + item-796 at level 5: text: -1 + item-797 at level 5: text: in subclinical ketosis [71] and by 0.02 kg CO + item-798 at level 5: text: 2 + item-799 at level 5: text: e (kg ECM) + item-800 at level 5: text: -1 + item-801 at level 5: text: in case of foot lesions [72]. + item-802 at level 4: inline: group group + item-803 at level 5: text: Grazing lands may also improve b ... n subtropical areas by 0.5 to 1.5 t ha + item-804 at level 5: text: -1 + item-805 at level 5: text: [75]. If 50% of tilled areas were under perennial grasslands, 1.0 t C ha + item-806 at level 5: text: -1 + item-807 at level 5: text: would be sequestered, further re ... e C footprint by 0.015 and 0.025 kg CO + item-808 at level 5: text: 2 + item-809 at level 5: text: e (kg ECM) + item-810 at level 5: text: -1 + item-811 at level 5: text: for the scenarios using 75 and 5 ... emissions would be 0.03 and 0.05 kg CO + item-812 at level 5: text: 2 + item-813 at level 5: text: e (kg ECM) + item-814 at level 5: text: -1 + item-815 at level 5: text: for 75 and 50% TMR, respectively ... C storage, so that net exchange of CO + item-816 at level 5: text: 2 + item-817 at level 5: text: would be negligible [76]. + item-818 at level 2: section_header: Conclusions + item-819 at level 3: inline: group group + item-820 at level 4: text: This study assessed the C footpr ... attributable to the evidence of low N + item-821 at level 4: text: 2 + item-822 at level 4: text: O emissions from urine and dung ... ical areas. Even though the enteric CH + item-823 at level 4: text: 4 + item-824 at level 4: text: intensity was the largest source of CO + item-825 at level 4: text: 2 + item-826 at level 4: text: e emissions, it did not change b ... on with or without access to pastures. + item-827 at level 2: section_header: Acknowledgments + item-828 at level 3: text: Thanks to Anna Naranjo for helpf ... of the herd considered in this study. + item-829 at level 2: section_header: References + item-830 at level 3: list: group list + item-831 at level 4: list_item: IPCC. Climate Change and Land. Chapter 5: Food Security. 2019. + item-832 at level 4: list_item: HerreroM, HendersonB, HavlíkP, T ... 2016;6: 452–461. 10.1038/nclimate2925 + item-833 at level 4: list_item: Rivera-FerreMG, López-i-GelatsF, ... hang. 2016;7: 869–892. 10.1002/wcc.421 + item-834 at level 4: list_item: van ZantenHHE, MollenhorstH, Klo ... 21: 747–758. 10.1007/s11367-015-0944-1 + item-835 at level 4: list_item: HristovAN, OhJ, FirkinsL, Dijkst ... 5–5069. 10.2527/jas.2013-6583 24045497 + item-836 at level 4: list_item: HristovAN, OttT, TricaricoJ, Rot ... 5–5113. 10.2527/jas.2013-6585 24045470 + item-837 at level 4: list_item: MontesF, MeinenR, DellC, RotzA, ... 0–5094. 10.2527/jas.2013-6584 24045493 + item-838 at level 4: list_item: LedgardSF, WeiS, WangX, Falconer ... : 155–163. 10.1016/j.agwat.2018.10.009 + item-839 at level 4: list_item: O’BrienD, ShallooL, PattonJ, Buc ... 107: 33–46. 10.1016/j.agsy.2011.11.004 + item-840 at level 4: list_item: SalouT, Le MouëlC, van der WerfH ... od. 2017 10.1016/j.jclepro.2016.05.019 + item-841 at level 4: list_item: LizarraldeC, PicassoV, RotzCA, C ... gric Res. 2014;3: 1 10.5539/sar.v3n2p1 + item-842 at level 4: list_item: ClarkCEF, KaurR, MillapanLO, Gol ... –5465. 10.3168/jds.2017-13388 29550132 + item-843 at level 4: list_item: Food and Agriculture Organization. FAOSTAT. 2017. + item-844 at level 4: list_item: VogelerI, MackayA, VibartR, Rend ... .1016/j.scitotenv.2016.05.006 27203517 + item-845 at level 4: list_item: WilkinsonJM, LeeMRF, RiveroMJ, C ... 0;75: 1–17. 10.1111/gfs.12458 32109974 + item-846 at level 4: list_item: WalesWJ, MarettLC, GreenwoodJS, ... i. 2013;53: 1167–1178. 10.1071/AN13207 + item-847 at level 4: list_item: BargoF, MullerLD, DelahoyJE, Cas ... 168/jds.S0022-0302(02)74381-6 12487461 + item-848 at level 4: list_item: VibartRE, FellnerV, BurnsJC, Hun ... 80. 10.1017/S0022029908003361 18701000 + item-849 at level 4: list_item: MendozaA, CajarvilleC, RepettoJL ... –1944. 10.3168/jds.2015-10257 26778319 + item-850 at level 4: list_item: NRC. Nutrient Requirements of Da ... gton DC: National Academy Press; 2001. + item-851 at level 4: list_item: INRA. INRA Feeding System for Ru ... shiers; 2018 10.3920/978-90-8686-872-8 + item-852 at level 4: list_item: LorenzH, ReinschT, HessS, TaubeF ... 161–170. 10.1016/j.jclepro.2018.11.113 + item-853 at level 4: list_item: ISO 14044. INTERNATIONAL STANDAR ... rements and guidelines. 2006;2006: 46. + item-854 at level 4: list_item: ISO 14040. The International Sta ... ;2006: 1–28. 10.1136/bmj.332.7550.1107 + item-855 at level 4: list_item: FAO. Environmental Performance o ... nerships/leap/resources/guidelines/en/ + item-856 at level 4: list_item: CivieroM, Ribeiro-FilhoHMN, Scha ... nce,. Foz do Iguaçu; 2019 pp. 141–141. + item-857 at level 4: list_item: IPCC—Intergovernmental Panel on ... /2018/05/SYR_AR5_FINAL_full_wcover.pdf + item-858 at level 4: list_item: INRA. Alimentation des bovins, o ... Inra 2007. 4th ed. INRA, editor. 2007. + item-859 at level 4: list_item: DelagardeR, FaverdinP, BaratteC, ... 5–60. 10.1111/j.1365-2494.2010.00770.x + item-860 at level 4: list_item: MaBL, LiangBC, BiswasDK, Morriso ... 2;94: 15–31. 10.1007/s10705-012-9522-0 + item-861 at level 4: list_item: RauccciGS, MoreiraCS, AlvesPS, M ... State. J Clean Prod. 2015;96: 418–425. + item-862 at level 4: list_item: CamargoGGT, RyanMR, RichardTL. E ... 3;63: 263–273. 10.1525/bio.2013.63.4.6 + item-863 at level 4: list_item: da SilvaMSJ, JobimCC, PoppiEC, T ... 3–313. 10.1590/S1806-92902015000900001 + item-864 at level 4: list_item: Duchini PGPGGuzatti GCGC, Ribeir ... Sci. 2016;67: 574–581. 10.1071/CP15170 + item-865 at level 4: list_item: ScaravelliLFB, PereiraLET, Olivo ... teiras. Cienc Rural. 2007;37: 841–846. + item-866 at level 4: list_item: SbrissiaAF, DuchiniPG, ZaniniGD, ... : 945–954. 10.2135/cropsci2017.07.0447 + item-867 at level 4: list_item: AlmeidaJGR, Dall-OrsolettaAC, Oz ... 12. 10.1017/S1751731119003057 31907089 + item-868 at level 4: list_item: Intergovernamental Panel on Clim ... Global Environmental Strategies; 2006. + item-869 at level 4: list_item: RamalhoB, DieckowJ, BarthG, Simo ... il Sci. 2020; 1–14. 10.1111/ejss.12933 + item-870 at level 4: list_item: FernandesHC, da SilveiraJCM, Rin ... –1587. 10.1590/s1413-70542008000500034 + item-871 at level 4: list_item: Wang M Q. GREET 1.8a Spreadsheet ... transportation.anl.gov/software/GREET/ + item-872 at level 4: list_item: RotzCAA, MontesF, ChianeseDS, Ch ... 6–1282. 10.3168/jds.2009-2162 20172247 + item-873 at level 4: list_item: NiuM, KebreabE, HristovAN, OhJ, ... 3368–3389. 10.1111/gcb.14094 29450980 + item-874 at level 4: list_item: EugèneM, SauvantD, NozièreP, Via ... 10.1016/j.jenvman.2018.10.086 30602259 + item-875 at level 4: list_item: ReedKF, MoraesLE, CasperDP, Kebr ... 5–3035. 10.3168/jds.2014-8397 25747829 + item-876 at level 4: list_item: BarrosMV, PiekarskiCM, De Franci ... . Energies. 2018;11 10.3390/en11061412 + item-877 at level 4: list_item: LudingtonD, JohnsonE. Dairy Farm ... York State Energy Res Dev Auth. 2003. + item-878 at level 4: list_item: ThomaG, JollietO, WangY. A bioph ... 2013;31 10.1016/j.idairyj.2012.08.012 + item-879 at level 4: list_item: NaranjoA, JohnsonA, RossowH. Gre ... . 2020 10.3168/jds.2019-16576 32037166 + item-880 at level 4: list_item: JayasundaraS, WordenD, WeersinkA ... 18–1028. 10.1016/j.jclepro.2019.04.013 + item-881 at level 4: list_item: WilliamsSRO, FisherPD, Berrisfor ... 4;19: 69–78. 10.1007/s11367-013-0619-8 + item-882 at level 4: list_item: GollnowS, LundieS, MooreAD, McLa ... : 31–38. 10.1016/j.idairyj.2014.02.005 + item-883 at level 4: list_item: O’BrienD, CapperJL, GarnsworthyP ... i. 2014 10.3168/jds.2013-7174 24440256 + item-884 at level 4: list_item: ChobtangJ, McLarenSJ, LedgardSF, ... 2017;21: 1139–1152. 10.1111/jiec.12484 + item-885 at level 4: list_item: GargMR, PhondbaBT, SherasiaPL, M ... Sci. 2016;56: 423–436. 10.1071/AN15464 + item-886 at level 4: list_item: de LéisCM, CherubiniE, RuviaroCF ... 5;20: 46–60. 10.1007/s11367-014-0813-3 + item-887 at level 4: list_item: O’BrienD, GeogheganA, McNamaraK, ... Sci. 2016;56: 495–500. 10.1071/AN15490 + item-888 at level 4: list_item: O’BrienD, BrennanP, HumphreysJ, ... : 1469–1481. 10.1007/s11367-014-0755-9 + item-889 at level 4: list_item: BaekCY, LeeKM, ParkKH. Quantific ... : 50–60. 10.1016/j.jclepro.2014.02.010 + item-890 at level 4: list_item: Dall-OrsolettaAC, AlmeidaJGR, Ca ... –4383. 10.3168/jds.2015-10396 27016830 + item-891 at level 4: list_item: Dall-OrsolettaAC, OziemblowskiMM ... 5–73. 10.1016/j.anifeedsci.2019.05.009 + item-892 at level 4: list_item: NiuM, AppuhamyJADRN, LeytemAB, D ... Sci. 2016;56: 312–321. 10.1071/AN15498 + item-893 at level 4: list_item: WaghornGC, LawN, BryantM, Pachec ... i. 2019;59: 1261–1270. 10.1071/AN18018 + item-894 at level 4: list_item: DickhoeferU, GlowackiS, GómezCA, ... 109–118. 10.1016/j.livsci.2018.08.004 + item-895 at level 4: list_item: SchwabCG, BroderickGA. A 100-Yea ... 10112. 10.3168/jds.2017-13320 29153157 + item-896 at level 4: list_item: SordiA, DieckowJ, BayerC, Alburq ... 90: 94–103. 10.1016/j.agee.2013.09.004 + item-897 at level 4: list_item: SimonPL, DieckowJ, de KleinCAM, ... 267: 74–82. 10.1016/j.agee.2018.08.013 + item-898 at level 4: list_item: WangX, LedgardS, LuoJ, GuoY, Zha ... .1016/j.scitotenv.2017.12.259 29291563 + item-899 at level 4: list_item: PirloG, LolliS. Environmental im ... 962–971. 10.1016/j.jclepro.2018.11.070 + item-900 at level 4: list_item: HerzogA, WincklerC, ZollitschW. ... 7: 174–187. 10.1016/j.agee.2018.07.029 + item-901 at level 4: list_item: MostertPF, van MiddelaarCE, Bokk ... od. 2018 10.1016/j.jclepro.2017.10.019 + item-902 at level 4: list_item: MostertPF, van MiddelaarCE, de B ... 7: 206–212. 10.1016/j.agsy.2018.09.006 + item-903 at level 4: list_item: FoleyJA, RamankuttyN, BraumanKA, ... 337–342. 10.1038/nature10452 21993620 + item-904 at level 4: list_item: LalR. Soil Carbon Sequestration ... 1627. 10.1126/science.1097396 15192216 + item-905 at level 4: list_item: BoddeyRM, JantaliaCP, ConceiçaoP ... –795. 10.1111/j.1365-2486.2009.02020.x + item-906 at level 4: list_item: McConkeyB, AngersD, BenthamM, Bo ... the LULUCF sector for NIR 2014. 2014. + item-907 at level 1: caption: Fig 1 Overview of the milk produ ... stem boundary considered in the study. + item-908 at level 1: caption: Table 1 Descriptive characteristics of the herd. + item-909 at level 1: caption: Table 2 Dairy cows’ diets in different scenariosa. + item-910 at level 1: caption: Table 3 GHG emission factors for Off- and On-farm feed production. + item-911 at level 1: caption: Table 4 GHG emissions from On-farm feed production. + item-912 at level 1: caption: Table 5 Factors for major resource inputs in farm management. + item-913 at level 1: caption: Fig 2 Overall greenhouse gas emi ... lectricity = 0.205 kg CO2e kWh-1 [46]. + item-914 at level 1: caption: Fig 3 Sensitivity of the C footp ... lectricity = 0.205 kg CO2e kWh-1 [46]. + item-915 at level 1: caption: Fig 4 Greenhouse gas emissions ( ... uestered CO2-C from perennial pasture. \ No newline at end of file diff --git a/tests/data/jats/groundtruth/pone.0234687.nxml.json b/tests/data/jats/groundtruth/pone.0234687.nxml.json index c084f0edfd..e665b95c67 100644 --- a/tests/data/jats/groundtruth/pone.0234687.nxml.json +++ b/tests/data/jats/groundtruth/pone.0234687.nxml.json @@ -27,25 +27,25 @@ "$ref": "#/texts/53" }, { - "$ref": "#/texts/102" + "$ref": "#/texts/104" }, { - "$ref": "#/texts/111" + "$ref": "#/texts/125" }, { - "$ref": "#/texts/143" + "$ref": "#/texts/194" }, { - "$ref": "#/texts/210" + "$ref": "#/texts/387" }, { - "$ref": "#/texts/276" + "$ref": "#/texts/489" }, { - "$ref": "#/texts/342" + "$ref": "#/texts/555" }, { - "$ref": "#/texts/392" + "$ref": "#/texts/605" } ], "content_layer": "body", @@ -214,15 +214,40 @@ { "self_ref": "#/groups/4", "parent": { - "$ref": "#/texts/54" + "$ref": "#/tables/0" }, "children": [ { - "$ref": "#/texts/55" - }, + "$ref": "#/groups/5" + } + ], + "content_layer": "body", + "name": "rich_cell_group_1_1_2", + "label": "unspecified" + }, + { + "self_ref": "#/groups/5", + "parent": { + "$ref": "#/groups/4" + }, + "children": [ { - "$ref": "#/texts/56" + "$ref": "#/texts/54" }, + { + "$ref": "#/texts/55" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/6", + "parent": { + "$ref": "#/texts/56" + }, + "children": [ { "$ref": "#/texts/57" }, @@ -249,6 +274,12 @@ }, { "$ref": "#/texts/65" + }, + { + "$ref": "#/texts/66" + }, + { + "$ref": "#/texts/67" } ], "content_layer": "body", @@ -256,17 +287,11 @@ "label": "inline" }, { - "self_ref": "#/groups/5", + "self_ref": "#/groups/7", "parent": { - "$ref": "#/texts/54" + "$ref": "#/texts/56" }, "children": [ - { - "$ref": "#/texts/66" - }, - { - "$ref": "#/texts/67" - }, { "$ref": "#/texts/68" }, @@ -281,6 +306,12 @@ }, { "$ref": "#/texts/72" + }, + { + "$ref": "#/texts/73" + }, + { + "$ref": "#/texts/74" } ], "content_layer": "body", @@ -288,17 +319,11 @@ "label": "inline" }, { - "self_ref": "#/groups/6", + "self_ref": "#/groups/8", "parent": { - "$ref": "#/texts/73" + "$ref": "#/texts/75" }, "children": [ - { - "$ref": "#/texts/74" - }, - { - "$ref": "#/texts/75" - }, { "$ref": "#/texts/76" }, @@ -349,6 +374,12 @@ }, { "$ref": "#/texts/92" + }, + { + "$ref": "#/texts/93" + }, + { + "$ref": "#/texts/94" } ], "content_layer": "body", @@ -356,17 +387,11 @@ "label": "inline" }, { - "self_ref": "#/groups/7", + "self_ref": "#/groups/9", "parent": { - "$ref": "#/texts/94" + "$ref": "#/texts/96" }, "children": [ - { - "$ref": "#/texts/95" - }, - { - "$ref": "#/texts/96" - }, { "$ref": "#/texts/97" }, @@ -381,6 +406,12 @@ }, { "$ref": "#/texts/101" + }, + { + "$ref": "#/texts/102" + }, + { + "$ref": "#/texts/103" } ], "content_layer": "body", @@ -388,26 +419,87 @@ "label": "inline" }, { - "self_ref": "#/groups/8", + "self_ref": "#/groups/10", "parent": { - "$ref": "#/texts/103" + "$ref": "#/tables/1" }, "children": [ { - "$ref": "#/texts/104" - }, + "$ref": "#/groups/11" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_0_3", + "label": "unspecified" + }, + { + "self_ref": "#/groups/11", + "parent": { + "$ref": "#/groups/10" + }, + "children": [ { "$ref": "#/texts/105" }, { "$ref": "#/texts/106" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/12", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/13" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_0_4", + "label": "unspecified" + }, + { + "self_ref": "#/groups/13", + "parent": { + "$ref": "#/groups/12" + }, + "children": [ { "$ref": "#/texts/107" }, { "$ref": "#/texts/108" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/14", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/15" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_0_11", + "label": "unspecified" + }, + { + "self_ref": "#/groups/15", + "parent": { + "$ref": "#/groups/14" + }, + "children": [ { "$ref": "#/texts/109" }, @@ -420,11 +512,28 @@ "label": "inline" }, { - "self_ref": "#/groups/9", + "self_ref": "#/groups/16", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/17" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_0_19", + "label": "unspecified" + }, + { + "self_ref": "#/groups/17", "parent": { - "$ref": "#/texts/103" + "$ref": "#/groups/16" }, "children": [ + { + "$ref": "#/texts/111" + }, { "$ref": "#/texts/112" }, @@ -433,16 +542,49 @@ }, { "$ref": "#/texts/114" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/18", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/19" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_0_20", + "label": "unspecified" + }, + { + "self_ref": "#/groups/19", + "parent": { + "$ref": "#/groups/18" + }, + "children": [ { "$ref": "#/texts/115" }, { "$ref": "#/texts/116" - }, - { - "$ref": "#/texts/117" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/20", + "parent": { + "$ref": "#/texts/117" + }, + "children": [ { "$ref": "#/texts/118" }, @@ -463,10 +605,32 @@ }, { "$ref": "#/texts/124" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/21", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ { - "$ref": "#/texts/125" - }, + "$ref": "#/groups/22" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_1_0", + "label": "unspecified" + }, + { + "self_ref": "#/groups/22", + "parent": { + "$ref": "#/groups/21" + }, + "children": [ { "$ref": "#/texts/126" }, @@ -475,13 +639,63 @@ }, { "$ref": "#/texts/128" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/23", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/24" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_3_0", + "label": "unspecified" + }, + { + "self_ref": "#/groups/24", + "parent": { + "$ref": "#/groups/23" + }, + "children": [ { "$ref": "#/texts/129" }, { "$ref": "#/texts/130" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/25", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/26" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_3_2", + "label": "unspecified" + }, + { + "self_ref": "#/groups/26", + "parent": { + "$ref": "#/groups/25" + }, + "children": [ { "$ref": "#/texts/131" }, @@ -493,7 +707,32 @@ }, { "$ref": "#/texts/134" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/27", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/28" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_3_3", + "label": "unspecified" + }, + { + "self_ref": "#/groups/28", + "parent": { + "$ref": "#/groups/27" + }, + "children": [ { "$ref": "#/texts/135" }, @@ -505,18 +744,74 @@ }, { "$ref": "#/texts/138" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/29", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/30" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_0_5", + "label": "unspecified" + }, + { + "self_ref": "#/groups/30", + "parent": { + "$ref": "#/groups/29" + }, + "children": [ { "$ref": "#/texts/139" }, { "$ref": "#/texts/140" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/31", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/32" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_3_5", + "label": "unspecified" + }, + { + "self_ref": "#/groups/32", + "parent": { + "$ref": "#/groups/31" + }, + "children": [ { "$ref": "#/texts/141" }, { "$ref": "#/texts/142" + }, + { + "$ref": "#/texts/143" + }, + { + "$ref": "#/texts/144" } ], "content_layer": "body", @@ -524,9 +819,23 @@ "label": "inline" }, { - "self_ref": "#/groups/10", + "self_ref": "#/groups/33", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/34" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_0_6", + "label": "unspecified" + }, + { + "self_ref": "#/groups/34", "parent": { - "$ref": "#/texts/144" + "$ref": "#/groups/33" }, "children": [ { @@ -534,7 +843,32 @@ }, { "$ref": "#/texts/146" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/35", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/36" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_3_6", + "label": "unspecified" + }, + { + "self_ref": "#/groups/36", + "parent": { + "$ref": "#/groups/35" + }, + "children": [ { "$ref": "#/texts/147" }, @@ -546,13 +880,63 @@ }, { "$ref": "#/texts/150" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/37", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/38" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_0_7", + "label": "unspecified" + }, + { + "self_ref": "#/groups/38", + "parent": { + "$ref": "#/groups/37" + }, + "children": [ { "$ref": "#/texts/151" }, { "$ref": "#/texts/152" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/39", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/40" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_3_7", + "label": "unspecified" + }, + { + "self_ref": "#/groups/40", + "parent": { + "$ref": "#/groups/39" + }, + "children": [ { "$ref": "#/texts/153" }, @@ -564,15 +948,37 @@ }, { "$ref": "#/texts/156" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/41", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/42" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_0_8", + "label": "unspecified" + }, + { + "self_ref": "#/groups/42", + "parent": { + "$ref": "#/groups/41" + }, + "children": [ { "$ref": "#/texts/157" }, { "$ref": "#/texts/158" - }, - { - "$ref": "#/texts/159" } ], "content_layer": "body", @@ -580,17 +986,48 @@ "label": "inline" }, { - "self_ref": "#/groups/11", + "self_ref": "#/groups/43", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/groups/44" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_3_8", + "label": "unspecified" + }, + { + "self_ref": "#/groups/44", "parent": { - "$ref": "#/texts/160" + "$ref": "#/groups/43" }, "children": [ + { + "$ref": "#/texts/159" + }, + { + "$ref": "#/texts/160" + }, { "$ref": "#/texts/161" }, { "$ref": "#/texts/162" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/45", + "parent": { + "$ref": "#/texts/117" + }, + "children": [ { "$ref": "#/texts/163" }, @@ -653,18 +1090,10 @@ }, { "$ref": "#/texts/183" - } - ], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/12", - "parent": { - "$ref": "#/texts/160" - }, - "children": [ + }, + { + "$ref": "#/texts/184" + }, { "$ref": "#/texts/185" }, @@ -691,25 +1120,97 @@ }, { "$ref": "#/texts/193" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/46", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ { - "$ref": "#/texts/194" - }, + "$ref": "#/groups/47" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_1", + "label": "unspecified" + }, + { + "self_ref": "#/groups/47", + "parent": { + "$ref": "#/groups/46" + }, + "children": [ { "$ref": "#/texts/195" }, { "$ref": "#/texts/196" - }, - { - "$ref": "#/texts/197" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/48", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/49" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_2", + "label": "unspecified" + }, + { + "self_ref": "#/groups/49", + "parent": { + "$ref": "#/groups/48" + }, + "children": [ + { + "$ref": "#/texts/197" + }, { "$ref": "#/texts/198" }, { "$ref": "#/texts/199" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/50", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/51" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_3", + "label": "unspecified" + }, + { + "self_ref": "#/groups/51", + "parent": { + "$ref": "#/groups/50" + }, + "children": [ { "$ref": "#/texts/200" }, @@ -718,7 +1219,32 @@ }, { "$ref": "#/texts/202" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/52", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/53" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_5", + "label": "unspecified" + }, + { + "self_ref": "#/groups/53", + "parent": { + "$ref": "#/groups/52" + }, + "children": [ { "$ref": "#/texts/203" }, @@ -727,12 +1253,46 @@ }, { "$ref": "#/texts/205" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/54", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/55" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_6", + "label": "unspecified" + }, + { + "self_ref": "#/groups/55", + "parent": { + "$ref": "#/groups/54" + }, + "children": [ { "$ref": "#/texts/206" }, { "$ref": "#/texts/207" + }, + { + "$ref": "#/texts/208" + }, + { + "$ref": "#/texts/209" + }, + { + "$ref": "#/texts/210" } ], "content_layer": "body", @@ -740,9 +1300,23 @@ "label": "inline" }, { - "self_ref": "#/groups/13", + "self_ref": "#/groups/56", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/57" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_7", + "label": "unspecified" + }, + { + "self_ref": "#/groups/57", "parent": { - "$ref": "#/texts/208" + "$ref": "#/groups/56" }, "children": [ { @@ -766,9 +1340,23 @@ "label": "inline" }, { - "self_ref": "#/groups/14", + "self_ref": "#/groups/58", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/59" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_8", + "label": "unspecified" + }, + { + "self_ref": "#/groups/59", "parent": { - "$ref": "#/texts/208" + "$ref": "#/groups/58" }, "children": [ { @@ -779,7 +1367,32 @@ }, { "$ref": "#/texts/218" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/60", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/61" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_9", + "label": "unspecified" + }, + { + "self_ref": "#/groups/61", + "parent": { + "$ref": "#/groups/60" + }, + "children": [ { "$ref": "#/texts/219" }, @@ -800,7 +1413,32 @@ }, { "$ref": "#/texts/225" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/62", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/63" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_10", + "label": "unspecified" + }, + { + "self_ref": "#/groups/63", + "parent": { + "$ref": "#/groups/62" + }, + "children": [ { "$ref": "#/texts/226" }, @@ -828,9 +1466,23 @@ "label": "inline" }, { - "self_ref": "#/groups/15", + "self_ref": "#/groups/64", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/65" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_11", + "label": "unspecified" + }, + { + "self_ref": "#/groups/65", "parent": { - "$ref": "#/texts/208" + "$ref": "#/groups/64" }, "children": [ { @@ -866,11 +1518,28 @@ "label": "inline" }, { - "self_ref": "#/groups/16", + "self_ref": "#/groups/66", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/67" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_12", + "label": "unspecified" + }, + { + "self_ref": "#/groups/67", "parent": { - "$ref": "#/texts/242" + "$ref": "#/groups/66" }, "children": [ + { + "$ref": "#/texts/242" + }, { "$ref": "#/texts/243" }, @@ -894,7 +1563,32 @@ }, { "$ref": "#/texts/250" - }, + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/68", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/69" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_13", + "label": "unspecified" + }, + { + "self_ref": "#/groups/69", + "parent": { + "$ref": "#/groups/68" + }, + "children": [ { "$ref": "#/texts/251" }, @@ -910,61 +1604,70 @@ "label": "inline" }, { - "self_ref": "#/groups/17", + "self_ref": "#/groups/70", "parent": { - "$ref": "#/texts/258" + "$ref": "#/tables/3" }, "children": [ { - "$ref": "#/texts/259" - }, - { - "$ref": "#/texts/260" - }, - { - "$ref": "#/texts/261" - }, - { - "$ref": "#/texts/262" - }, - { - "$ref": "#/texts/263" - }, - { - "$ref": "#/texts/264" - }, - { - "$ref": "#/texts/265" - }, - { - "$ref": "#/texts/266" - }, - { - "$ref": "#/texts/267" - }, + "$ref": "#/groups/71" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_14", + "label": "unspecified" + }, + { + "self_ref": "#/groups/71", + "parent": { + "$ref": "#/groups/70" + }, + "children": [ { - "$ref": "#/texts/268" + "$ref": "#/texts/254" }, { - "$ref": "#/texts/269" + "$ref": "#/texts/255" }, { - "$ref": "#/texts/270" - }, + "$ref": "#/texts/256" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/72", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ { - "$ref": "#/texts/271" - }, + "$ref": "#/groups/73" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_15", + "label": "unspecified" + }, + { + "self_ref": "#/groups/73", + "parent": { + "$ref": "#/groups/72" + }, + "children": [ { - "$ref": "#/texts/272" + "$ref": "#/texts/257" }, { - "$ref": "#/texts/273" + "$ref": "#/texts/258" }, { - "$ref": "#/texts/274" + "$ref": "#/texts/259" }, { - "$ref": "#/texts/275" + "$ref": "#/texts/260" } ], "content_layer": "body", @@ -972,97 +1675,128 @@ "label": "inline" }, { - "self_ref": "#/groups/18", + "self_ref": "#/groups/74", "parent": { - "$ref": "#/texts/258" + "$ref": "#/tables/3" }, "children": [ { - "$ref": "#/texts/277" - }, - { - "$ref": "#/texts/278" - }, - { - "$ref": "#/texts/279" - }, - { - "$ref": "#/texts/280" - }, - { - "$ref": "#/texts/281" - }, - { - "$ref": "#/texts/282" - }, - { - "$ref": "#/texts/283" - }, - { - "$ref": "#/texts/284" - }, - { - "$ref": "#/texts/285" - }, + "$ref": "#/groups/75" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_16", + "label": "unspecified" + }, + { + "self_ref": "#/groups/75", + "parent": { + "$ref": "#/groups/74" + }, + "children": [ { - "$ref": "#/texts/286" + "$ref": "#/texts/261" }, { - "$ref": "#/texts/287" + "$ref": "#/texts/262" }, { - "$ref": "#/texts/288" + "$ref": "#/texts/263" }, { - "$ref": "#/texts/289" + "$ref": "#/texts/264" }, { - "$ref": "#/texts/290" - }, + "$ref": "#/texts/265" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/76", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ { - "$ref": "#/texts/291" - }, + "$ref": "#/groups/77" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_17", + "label": "unspecified" + }, + { + "self_ref": "#/groups/77", + "parent": { + "$ref": "#/groups/76" + }, + "children": [ { - "$ref": "#/texts/292" + "$ref": "#/texts/266" }, { - "$ref": "#/texts/293" + "$ref": "#/texts/267" }, { - "$ref": "#/texts/294" + "$ref": "#/texts/268" }, { - "$ref": "#/texts/295" + "$ref": "#/texts/269" }, { - "$ref": "#/texts/296" - }, + "$ref": "#/texts/270" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/78", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ { - "$ref": "#/texts/297" - }, + "$ref": "#/groups/79" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_18", + "label": "unspecified" + }, + { + "self_ref": "#/groups/79", + "parent": { + "$ref": "#/groups/78" + }, + "children": [ { - "$ref": "#/texts/298" + "$ref": "#/texts/271" }, { - "$ref": "#/texts/299" + "$ref": "#/texts/272" }, { - "$ref": "#/texts/300" + "$ref": "#/texts/273" }, { - "$ref": "#/texts/301" + "$ref": "#/texts/274" }, { - "$ref": "#/texts/302" + "$ref": "#/texts/275" }, { - "$ref": "#/texts/303" + "$ref": "#/texts/276" }, { - "$ref": "#/texts/304" + "$ref": "#/texts/277" }, { - "$ref": "#/texts/305" + "$ref": "#/texts/278" } ], "content_layer": "body", @@ -1070,37 +1804,42 @@ "label": "inline" }, { - "self_ref": "#/groups/19", + "self_ref": "#/groups/80", "parent": { - "$ref": "#/texts/258" + "$ref": "#/tables/3" }, "children": [ { - "$ref": "#/texts/306" - }, - { - "$ref": "#/texts/307" - }, - { - "$ref": "#/texts/308" - }, + "$ref": "#/groups/81" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_19", + "label": "unspecified" + }, + { + "self_ref": "#/groups/81", + "parent": { + "$ref": "#/groups/80" + }, + "children": [ { - "$ref": "#/texts/309" + "$ref": "#/texts/279" }, { - "$ref": "#/texts/310" + "$ref": "#/texts/280" }, { - "$ref": "#/texts/311" + "$ref": "#/texts/281" }, { - "$ref": "#/texts/312" + "$ref": "#/texts/282" }, { - "$ref": "#/texts/313" + "$ref": "#/texts/283" }, { - "$ref": "#/texts/314" + "$ref": "#/texts/284" } ], "content_layer": "body", @@ -1108,49 +1847,79 @@ "label": "inline" }, { - "self_ref": "#/groups/20", + "self_ref": "#/groups/82", "parent": { - "$ref": "#/texts/258" + "$ref": "#/tables/3" }, "children": [ { - "$ref": "#/texts/315" - }, - { - "$ref": "#/texts/316" - }, + "$ref": "#/groups/83" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_20", + "label": "unspecified" + }, + { + "self_ref": "#/groups/83", + "parent": { + "$ref": "#/groups/82" + }, + "children": [ { - "$ref": "#/texts/317" + "$ref": "#/texts/285" }, { - "$ref": "#/texts/318" + "$ref": "#/texts/286" }, { - "$ref": "#/texts/319" + "$ref": "#/texts/287" }, { - "$ref": "#/texts/320" + "$ref": "#/texts/288" }, { - "$ref": "#/texts/321" + "$ref": "#/texts/289" }, { - "$ref": "#/texts/322" - }, + "$ref": "#/texts/290" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/84", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ { - "$ref": "#/texts/323" - }, + "$ref": "#/groups/85" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_21", + "label": "unspecified" + }, + { + "self_ref": "#/groups/85", + "parent": { + "$ref": "#/groups/84" + }, + "children": [ { - "$ref": "#/texts/324" + "$ref": "#/texts/291" }, { - "$ref": "#/texts/325" + "$ref": "#/texts/292" }, { - "$ref": "#/texts/326" + "$ref": "#/texts/293" }, { - "$ref": "#/texts/327" + "$ref": "#/texts/294" } ], "content_layer": "body", @@ -1158,49 +1927,76 @@ "label": "inline" }, { - "self_ref": "#/groups/21", + "self_ref": "#/groups/86", "parent": { - "$ref": "#/texts/328" + "$ref": "#/tables/3" }, "children": [ { - "$ref": "#/texts/329" - }, - { - "$ref": "#/texts/330" - }, - { - "$ref": "#/texts/331" - }, + "$ref": "#/groups/87" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_22", + "label": "unspecified" + }, + { + "self_ref": "#/groups/87", + "parent": { + "$ref": "#/groups/86" + }, + "children": [ { - "$ref": "#/texts/332" + "$ref": "#/texts/295" }, { - "$ref": "#/texts/333" + "$ref": "#/texts/296" }, { - "$ref": "#/texts/334" + "$ref": "#/texts/297" }, { - "$ref": "#/texts/335" - }, + "$ref": "#/texts/298" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/88", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ { - "$ref": "#/texts/336" - }, + "$ref": "#/groups/89" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_23", + "label": "unspecified" + }, + { + "self_ref": "#/groups/89", + "parent": { + "$ref": "#/groups/88" + }, + "children": [ { - "$ref": "#/texts/337" + "$ref": "#/texts/299" }, { - "$ref": "#/texts/338" + "$ref": "#/texts/300" }, { - "$ref": "#/texts/339" + "$ref": "#/texts/301" }, { - "$ref": "#/texts/340" + "$ref": "#/texts/302" }, { - "$ref": "#/texts/341" + "$ref": "#/texts/303" } ], "content_layer": "body", @@ -1208,49 +2004,110 @@ "label": "inline" }, { - "self_ref": "#/groups/22", + "self_ref": "#/groups/90", "parent": { - "$ref": "#/texts/328" + "$ref": "#/tables/3" }, "children": [ { - "$ref": "#/texts/343" - }, - { - "$ref": "#/texts/344" - }, + "$ref": "#/groups/91" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_24", + "label": "unspecified" + }, + { + "self_ref": "#/groups/91", + "parent": { + "$ref": "#/groups/90" + }, + "children": [ { - "$ref": "#/texts/345" + "$ref": "#/texts/304" }, { - "$ref": "#/texts/346" + "$ref": "#/texts/305" }, { - "$ref": "#/texts/347" - }, + "$ref": "#/texts/306" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/92", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ { - "$ref": "#/texts/348" + "$ref": "#/groups/93" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_25", + "label": "unspecified" + }, + { + "self_ref": "#/groups/93", + "parent": { + "$ref": "#/groups/92" + }, + "children": [ + { + "$ref": "#/texts/307" }, { - "$ref": "#/texts/349" + "$ref": "#/texts/308" }, { - "$ref": "#/texts/350" + "$ref": "#/texts/309" }, { - "$ref": "#/texts/351" + "$ref": "#/texts/310" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/94", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/groups/95" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_26", + "label": "unspecified" + }, + { + "self_ref": "#/groups/95", + "parent": { + "$ref": "#/groups/94" + }, + "children": [ + { + "$ref": "#/texts/311" }, { - "$ref": "#/texts/352" + "$ref": "#/texts/312" }, { - "$ref": "#/texts/353" + "$ref": "#/texts/313" }, { - "$ref": "#/texts/354" + "$ref": "#/texts/314" }, { - "$ref": "#/texts/355" + "$ref": "#/texts/315" } ], "content_layer": "body", @@ -1258,153 +2115,175 @@ "label": "inline" }, { - "self_ref": "#/groups/23", + "self_ref": "#/groups/96", "parent": { - "$ref": "#/texts/356" + "$ref": "#/tables/3" }, "children": [ { - "$ref": "#/texts/357" - }, + "$ref": "#/groups/97" + } + ], + "content_layer": "body", + "name": "rich_cell_group_4_0_27", + "label": "unspecified" + }, + { + "self_ref": "#/groups/97", + "parent": { + "$ref": "#/groups/96" + }, + "children": [ { - "$ref": "#/texts/358" + "$ref": "#/texts/316" }, { - "$ref": "#/texts/359" + "$ref": "#/texts/317" }, { - "$ref": "#/texts/360" + "$ref": "#/texts/318" }, { - "$ref": "#/texts/361" + "$ref": "#/texts/319" }, { - "$ref": "#/texts/362" - }, + "$ref": "#/texts/320" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/98", + "parent": { + "$ref": "#/texts/321" + }, + "children": [ { - "$ref": "#/texts/363" + "$ref": "#/texts/322" }, { - "$ref": "#/texts/364" + "$ref": "#/texts/323" }, { - "$ref": "#/texts/365" + "$ref": "#/texts/324" }, { - "$ref": "#/texts/366" + "$ref": "#/texts/325" }, { - "$ref": "#/texts/367" + "$ref": "#/texts/326" }, { - "$ref": "#/texts/368" + "$ref": "#/texts/327" }, { - "$ref": "#/texts/369" + "$ref": "#/texts/328" }, { - "$ref": "#/texts/370" + "$ref": "#/texts/329" }, { - "$ref": "#/texts/371" + "$ref": "#/texts/330" }, { - "$ref": "#/texts/372" + "$ref": "#/texts/331" }, { - "$ref": "#/texts/373" + "$ref": "#/texts/332" }, { - "$ref": "#/texts/374" + "$ref": "#/texts/333" }, { - "$ref": "#/texts/375" + "$ref": "#/texts/334" }, { - "$ref": "#/texts/376" + "$ref": "#/texts/335" }, { - "$ref": "#/texts/377" - }, + "$ref": "#/texts/336" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/99", + "parent": { + "$ref": "#/texts/337" + }, + "children": [ { - "$ref": "#/texts/378" + "$ref": "#/texts/338" }, { - "$ref": "#/texts/379" + "$ref": "#/texts/339" }, { - "$ref": "#/texts/380" + "$ref": "#/texts/340" }, { - "$ref": "#/texts/381" + "$ref": "#/texts/341" }, { - "$ref": "#/texts/382" + "$ref": "#/texts/342" }, { - "$ref": "#/texts/383" + "$ref": "#/texts/343" }, { - "$ref": "#/texts/384" + "$ref": "#/texts/344" }, { - "$ref": "#/texts/385" + "$ref": "#/texts/345" }, { - "$ref": "#/texts/386" + "$ref": "#/texts/346" }, { - "$ref": "#/texts/387" + "$ref": "#/texts/347" }, { - "$ref": "#/texts/388" + "$ref": "#/texts/348" }, { - "$ref": "#/texts/389" + "$ref": "#/texts/349" }, { - "$ref": "#/texts/390" + "$ref": "#/texts/350" }, { - "$ref": "#/texts/391" - } - ], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/24", - "parent": { - "$ref": "#/texts/356" - }, - "children": [ + "$ref": "#/texts/351" + }, { - "$ref": "#/texts/393" + "$ref": "#/texts/352" }, { - "$ref": "#/texts/394" + "$ref": "#/texts/353" }, { - "$ref": "#/texts/395" + "$ref": "#/texts/354" }, { - "$ref": "#/texts/396" + "$ref": "#/texts/355" }, { - "$ref": "#/texts/397" + "$ref": "#/texts/356" }, { - "$ref": "#/texts/398" + "$ref": "#/texts/357" }, { - "$ref": "#/texts/399" + "$ref": "#/texts/358" }, { - "$ref": "#/texts/400" + "$ref": "#/texts/359" }, { - "$ref": "#/texts/401" + "$ref": "#/texts/360" } ], "content_layer": "body", @@ -1412,87 +2291,79 @@ "label": "inline" }, { - "self_ref": "#/groups/25", + "self_ref": "#/groups/100", "parent": { - "$ref": "#/texts/403" + "$ref": "#/texts/337" }, "children": [ { - "$ref": "#/texts/405" + "$ref": "#/texts/362" }, { - "$ref": "#/texts/406" + "$ref": "#/texts/363" }, { - "$ref": "#/texts/407" + "$ref": "#/texts/364" }, { - "$ref": "#/texts/408" + "$ref": "#/texts/365" }, { - "$ref": "#/texts/409" + "$ref": "#/texts/366" }, { - "$ref": "#/texts/410" + "$ref": "#/texts/367" }, { - "$ref": "#/texts/411" + "$ref": "#/texts/368" }, { - "$ref": "#/texts/412" + "$ref": "#/texts/369" }, { - "$ref": "#/texts/413" + "$ref": "#/texts/370" }, { - "$ref": "#/texts/414" + "$ref": "#/texts/371" }, { - "$ref": "#/texts/415" + "$ref": "#/texts/372" }, { - "$ref": "#/texts/416" + "$ref": "#/texts/373" }, { - "$ref": "#/texts/417" + "$ref": "#/texts/374" }, { - "$ref": "#/texts/418" + "$ref": "#/texts/375" }, { - "$ref": "#/texts/419" + "$ref": "#/texts/376" }, { - "$ref": "#/texts/420" + "$ref": "#/texts/377" }, { - "$ref": "#/texts/421" - } - ], - "content_layer": "body", - "name": "group", - "label": "inline" - }, - { - "self_ref": "#/groups/26", - "parent": { - "$ref": "#/texts/422" - }, - "children": [ + "$ref": "#/texts/378" + }, { - "$ref": "#/texts/423" + "$ref": "#/texts/379" }, { - "$ref": "#/texts/424" + "$ref": "#/texts/380" }, { - "$ref": "#/texts/425" + "$ref": "#/texts/381" }, { - "$ref": "#/texts/426" + "$ref": "#/texts/382" }, { - "$ref": "#/texts/427" + "$ref": "#/texts/383" + }, + { + "$ref": "#/texts/384" } ], "content_layer": "body", @@ -1500,61 +2371,135 @@ "label": "inline" }, { - "self_ref": "#/groups/27", + "self_ref": "#/groups/101", "parent": { - "$ref": "#/texts/428" + "$ref": "#/tables/4" }, "children": [ { - "$ref": "#/texts/429" - }, - { - "$ref": "#/texts/430" - }, + "$ref": "#/groups/102" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_0", + "label": "unspecified" + }, + { + "self_ref": "#/groups/102", + "parent": { + "$ref": "#/groups/101" + }, + "children": [ { - "$ref": "#/texts/431" + "$ref": "#/texts/388" }, { - "$ref": "#/texts/432" - }, + "$ref": "#/texts/389" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/103", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/433" - }, + "$ref": "#/groups/104" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_1", + "label": "unspecified" + }, + { + "self_ref": "#/groups/104", + "parent": { + "$ref": "#/groups/103" + }, + "children": [ { - "$ref": "#/texts/434" + "$ref": "#/texts/390" }, { - "$ref": "#/texts/435" + "$ref": "#/texts/391" }, { - "$ref": "#/texts/436" + "$ref": "#/texts/392" }, { - "$ref": "#/texts/437" - }, + "$ref": "#/texts/393" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/105", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/438" - }, + "$ref": "#/groups/106" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_2", + "label": "unspecified" + }, + { + "self_ref": "#/groups/106", + "parent": { + "$ref": "#/groups/105" + }, + "children": [ { - "$ref": "#/texts/439" + "$ref": "#/texts/394" }, { - "$ref": "#/texts/440" + "$ref": "#/texts/395" }, { - "$ref": "#/texts/441" + "$ref": "#/texts/396" }, { - "$ref": "#/texts/442" - }, + "$ref": "#/texts/397" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/107", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/443" - }, + "$ref": "#/groups/108" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_0_3", + "label": "unspecified" + }, + { + "self_ref": "#/groups/108", + "parent": { + "$ref": "#/groups/107" + }, + "children": [ { - "$ref": "#/texts/444" + "$ref": "#/texts/398" }, { - "$ref": "#/texts/445" + "$ref": "#/texts/399" } ], "content_layer": "body", @@ -1562,55 +2507,104 @@ "label": "inline" }, { - "self_ref": "#/groups/28", + "self_ref": "#/groups/109", "parent": { - "$ref": "#/texts/428" + "$ref": "#/tables/4" }, "children": [ { - "$ref": "#/texts/446" - }, - { - "$ref": "#/texts/447" - }, - { - "$ref": "#/texts/448" - }, + "$ref": "#/groups/110" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_3", + "label": "unspecified" + }, + { + "self_ref": "#/groups/110", + "parent": { + "$ref": "#/groups/109" + }, + "children": [ { - "$ref": "#/texts/449" + "$ref": "#/texts/400" }, { - "$ref": "#/texts/450" + "$ref": "#/texts/401" }, { - "$ref": "#/texts/451" + "$ref": "#/texts/402" }, { - "$ref": "#/texts/452" - }, + "$ref": "#/texts/403" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/111", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/453" - }, + "$ref": "#/groups/112" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_0_4", + "label": "unspecified" + }, + { + "self_ref": "#/groups/112", + "parent": { + "$ref": "#/groups/111" + }, + "children": [ { - "$ref": "#/texts/454" + "$ref": "#/texts/404" }, { - "$ref": "#/texts/455" - }, + "$ref": "#/texts/405" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/113", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/456" - }, + "$ref": "#/groups/114" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_4", + "label": "unspecified" + }, + { + "self_ref": "#/groups/114", + "parent": { + "$ref": "#/groups/113" + }, + "children": [ { - "$ref": "#/texts/457" + "$ref": "#/texts/406" }, { - "$ref": "#/texts/458" + "$ref": "#/texts/407" }, { - "$ref": "#/texts/459" + "$ref": "#/texts/408" }, { - "$ref": "#/texts/460" + "$ref": "#/texts/409" } ], "content_layer": "body", @@ -1618,31 +2612,36 @@ "label": "inline" }, { - "self_ref": "#/groups/29", + "self_ref": "#/groups/115", "parent": { - "$ref": "#/texts/461" + "$ref": "#/tables/4" }, "children": [ { - "$ref": "#/texts/462" - }, - { - "$ref": "#/texts/463" - }, - { - "$ref": "#/texts/464" - }, + "$ref": "#/groups/116" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_5", + "label": "unspecified" + }, + { + "self_ref": "#/groups/116", + "parent": { + "$ref": "#/groups/115" + }, + "children": [ { - "$ref": "#/texts/465" + "$ref": "#/texts/410" }, { - "$ref": "#/texts/466" + "$ref": "#/texts/411" }, { - "$ref": "#/texts/467" + "$ref": "#/texts/412" }, { - "$ref": "#/texts/468" + "$ref": "#/texts/413" } ], "content_layer": "body", @@ -1650,343 +2649,4691 @@ "label": "inline" }, { - "self_ref": "#/groups/30", + "self_ref": "#/groups/117", "parent": { - "$ref": "#/texts/471" + "$ref": "#/tables/4" }, "children": [ { - "$ref": "#/texts/472" - }, - { - "$ref": "#/texts/473" - }, + "$ref": "#/groups/118" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_7", + "label": "unspecified" + }, + { + "self_ref": "#/groups/118", + "parent": { + "$ref": "#/groups/117" + }, + "children": [ { - "$ref": "#/texts/474" + "$ref": "#/texts/414" }, { - "$ref": "#/texts/475" - }, + "$ref": "#/texts/415" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/119", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/476" - }, + "$ref": "#/groups/120" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_8", + "label": "unspecified" + }, + { + "self_ref": "#/groups/120", + "parent": { + "$ref": "#/groups/119" + }, + "children": [ { - "$ref": "#/texts/477" + "$ref": "#/texts/416" }, { - "$ref": "#/texts/478" - }, - { - "$ref": "#/texts/479" - }, + "$ref": "#/texts/417" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/121", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/480" - }, + "$ref": "#/groups/122" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_10", + "label": "unspecified" + }, + { + "self_ref": "#/groups/122", + "parent": { + "$ref": "#/groups/121" + }, + "children": [ { - "$ref": "#/texts/481" + "$ref": "#/texts/418" }, { - "$ref": "#/texts/482" - }, + "$ref": "#/texts/419" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/123", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/483" - }, + "$ref": "#/groups/124" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_0_11", + "label": "unspecified" + }, + { + "self_ref": "#/groups/124", + "parent": { + "$ref": "#/groups/123" + }, + "children": [ { - "$ref": "#/texts/484" + "$ref": "#/texts/420" }, { - "$ref": "#/texts/485" - }, + "$ref": "#/texts/421" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/125", + "parent": { + "$ref": "#/tables/4" + }, + "children": [ { - "$ref": "#/texts/486" - }, + "$ref": "#/groups/126" + } + ], + "content_layer": "body", + "name": "rich_cell_group_5_2_11", + "label": "unspecified" + }, + { + "self_ref": "#/groups/126", + "parent": { + "$ref": "#/groups/125" + }, + "children": [ { - "$ref": "#/texts/487" + "$ref": "#/texts/422" }, { - "$ref": "#/texts/488" - }, + "$ref": "#/texts/423" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/127", + "parent": { + "$ref": "#/texts/385" + }, + "children": [ { - "$ref": "#/texts/489" + "$ref": "#/texts/424" }, { - "$ref": "#/texts/490" + "$ref": "#/texts/425" }, { - "$ref": "#/texts/491" + "$ref": "#/texts/426" }, { - "$ref": "#/texts/492" + "$ref": "#/texts/427" }, { - "$ref": "#/texts/493" - }, + "$ref": "#/texts/428" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/128", + "parent": { + "$ref": "#/texts/385" + }, + "children": [ { - "$ref": "#/texts/494" + "$ref": "#/texts/429" }, { - "$ref": "#/texts/495" + "$ref": "#/texts/430" }, { - "$ref": "#/texts/496" + "$ref": "#/texts/431" }, { - "$ref": "#/texts/497" + "$ref": "#/texts/432" }, { - "$ref": "#/texts/498" + "$ref": "#/texts/433" }, { - "$ref": "#/texts/499" + "$ref": "#/texts/434" }, { - "$ref": "#/texts/500" + "$ref": "#/texts/435" }, { - "$ref": "#/texts/501" + "$ref": "#/texts/436" }, { - "$ref": "#/texts/502" + "$ref": "#/texts/437" }, { - "$ref": "#/texts/503" + "$ref": "#/texts/438" }, { - "$ref": "#/texts/504" + "$ref": "#/texts/439" }, { - "$ref": "#/texts/505" + "$ref": "#/texts/440" }, { - "$ref": "#/texts/506" + "$ref": "#/texts/441" }, { - "$ref": "#/texts/507" + "$ref": "#/texts/442" }, { - "$ref": "#/texts/508" + "$ref": "#/texts/443" }, { - "$ref": "#/texts/509" + "$ref": "#/texts/444" }, { - "$ref": "#/texts/510" - }, + "$ref": "#/texts/445" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/129", + "parent": { + "$ref": "#/texts/385" + }, + "children": [ { - "$ref": "#/texts/511" + "$ref": "#/texts/446" }, { - "$ref": "#/texts/512" + "$ref": "#/texts/447" }, { - "$ref": "#/texts/513" + "$ref": "#/texts/448" }, { - "$ref": "#/texts/514" + "$ref": "#/texts/449" }, { - "$ref": "#/texts/515" + "$ref": "#/texts/450" }, { - "$ref": "#/texts/516" + "$ref": "#/texts/451" }, { - "$ref": "#/texts/517" + "$ref": "#/texts/452" }, { - "$ref": "#/texts/518" + "$ref": "#/texts/453" }, { - "$ref": "#/texts/519" - }, + "$ref": "#/texts/454" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/130", + "parent": { + "$ref": "#/texts/455" + }, + "children": [ { - "$ref": "#/texts/520" + "$ref": "#/texts/456" }, { - "$ref": "#/texts/521" + "$ref": "#/texts/457" }, { - "$ref": "#/texts/522" + "$ref": "#/texts/458" }, { - "$ref": "#/texts/523" + "$ref": "#/texts/459" }, { - "$ref": "#/texts/524" + "$ref": "#/texts/460" }, { - "$ref": "#/texts/525" + "$ref": "#/texts/461" }, { - "$ref": "#/texts/526" + "$ref": "#/texts/462" }, { - "$ref": "#/texts/527" + "$ref": "#/texts/463" }, { - "$ref": "#/texts/528" + "$ref": "#/texts/464" }, { - "$ref": "#/texts/529" + "$ref": "#/texts/465" }, { - "$ref": "#/texts/530" - }, + "$ref": "#/texts/466" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/131", + "parent": { + "$ref": "#/texts/471" + }, + "children": [ { - "$ref": "#/texts/531" + "$ref": "#/texts/472" }, { - "$ref": "#/texts/532" + "$ref": "#/texts/473" }, { - "$ref": "#/texts/533" + "$ref": "#/texts/474" }, { - "$ref": "#/texts/534" + "$ref": "#/texts/475" }, { - "$ref": "#/texts/535" + "$ref": "#/texts/476" }, { - "$ref": "#/texts/536" + "$ref": "#/texts/477" }, { - "$ref": "#/texts/537" + "$ref": "#/texts/478" }, { - "$ref": "#/texts/538" + "$ref": "#/texts/479" }, { - "$ref": "#/texts/539" + "$ref": "#/texts/480" }, { - "$ref": "#/texts/540" + "$ref": "#/texts/481" }, { - "$ref": "#/texts/541" + "$ref": "#/texts/482" }, { - "$ref": "#/texts/542" + "$ref": "#/texts/483" }, { - "$ref": "#/texts/543" + "$ref": "#/texts/484" }, { - "$ref": "#/texts/544" + "$ref": "#/texts/485" }, { - "$ref": "#/texts/545" + "$ref": "#/texts/486" }, { - "$ref": "#/texts/546" + "$ref": "#/texts/487" }, { - "$ref": "#/texts/547" + "$ref": "#/texts/488" } ], "content_layer": "body", - "name": "list", - "label": "list" - } - ], - "texts": [ + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/132", + "parent": { + "$ref": "#/texts/471" + }, + "children": [ + { + "$ref": "#/texts/490" + }, + { + "$ref": "#/texts/491" + }, + { + "$ref": "#/texts/492" + }, + { + "$ref": "#/texts/493" + }, + { + "$ref": "#/texts/494" + }, + { + "$ref": "#/texts/495" + }, + { + "$ref": "#/texts/496" + }, + { + "$ref": "#/texts/497" + }, + { + "$ref": "#/texts/498" + }, + { + "$ref": "#/texts/499" + }, + { + "$ref": "#/texts/500" + }, + { + "$ref": "#/texts/501" + }, + { + "$ref": "#/texts/502" + }, + { + "$ref": "#/texts/503" + }, + { + "$ref": "#/texts/504" + }, + { + "$ref": "#/texts/505" + }, + { + "$ref": "#/texts/506" + }, + { + "$ref": "#/texts/507" + }, + { + "$ref": "#/texts/508" + }, + { + "$ref": "#/texts/509" + }, + { + "$ref": "#/texts/510" + }, + { + "$ref": "#/texts/511" + }, + { + "$ref": "#/texts/512" + }, + { + "$ref": "#/texts/513" + }, + { + "$ref": "#/texts/514" + }, + { + "$ref": "#/texts/515" + }, + { + "$ref": "#/texts/516" + }, + { + "$ref": "#/texts/517" + }, + { + "$ref": "#/texts/518" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/133", + "parent": { + "$ref": "#/texts/471" + }, + "children": [ + { + "$ref": "#/texts/519" + }, + { + "$ref": "#/texts/520" + }, + { + "$ref": "#/texts/521" + }, + { + "$ref": "#/texts/522" + }, + { + "$ref": "#/texts/523" + }, + { + "$ref": "#/texts/524" + }, + { + "$ref": "#/texts/525" + }, + { + "$ref": "#/texts/526" + }, + { + "$ref": "#/texts/527" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/134", + "parent": { + "$ref": "#/texts/471" + }, + "children": [ + { + "$ref": "#/texts/528" + }, + { + "$ref": "#/texts/529" + }, + { + "$ref": "#/texts/530" + }, + { + "$ref": "#/texts/531" + }, + { + "$ref": "#/texts/532" + }, + { + "$ref": "#/texts/533" + }, + { + "$ref": "#/texts/534" + }, + { + "$ref": "#/texts/535" + }, + { + "$ref": "#/texts/536" + }, + { + "$ref": "#/texts/537" + }, + { + "$ref": "#/texts/538" + }, + { + "$ref": "#/texts/539" + }, + { + "$ref": "#/texts/540" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/135", + "parent": { + "$ref": "#/texts/541" + }, + "children": [ + { + "$ref": "#/texts/542" + }, + { + "$ref": "#/texts/543" + }, + { + "$ref": "#/texts/544" + }, + { + "$ref": "#/texts/545" + }, + { + "$ref": "#/texts/546" + }, + { + "$ref": "#/texts/547" + }, + { + "$ref": "#/texts/548" + }, + { + "$ref": "#/texts/549" + }, + { + "$ref": "#/texts/550" + }, + { + "$ref": "#/texts/551" + }, + { + "$ref": "#/texts/552" + }, + { + "$ref": "#/texts/553" + }, + { + "$ref": "#/texts/554" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/136", + "parent": { + "$ref": "#/texts/541" + }, + "children": [ + { + "$ref": "#/texts/556" + }, + { + "$ref": "#/texts/557" + }, + { + "$ref": "#/texts/558" + }, + { + "$ref": "#/texts/559" + }, + { + "$ref": "#/texts/560" + }, + { + "$ref": "#/texts/561" + }, + { + "$ref": "#/texts/562" + }, + { + "$ref": "#/texts/563" + }, + { + "$ref": "#/texts/564" + }, + { + "$ref": "#/texts/565" + }, + { + "$ref": "#/texts/566" + }, + { + "$ref": "#/texts/567" + }, + { + "$ref": "#/texts/568" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/137", + "parent": { + "$ref": "#/texts/569" + }, + "children": [ + { + "$ref": "#/texts/570" + }, + { + "$ref": "#/texts/571" + }, + { + "$ref": "#/texts/572" + }, + { + "$ref": "#/texts/573" + }, + { + "$ref": "#/texts/574" + }, + { + "$ref": "#/texts/575" + }, + { + "$ref": "#/texts/576" + }, + { + "$ref": "#/texts/577" + }, + { + "$ref": "#/texts/578" + }, + { + "$ref": "#/texts/579" + }, + { + "$ref": "#/texts/580" + }, + { + "$ref": "#/texts/581" + }, + { + "$ref": "#/texts/582" + }, + { + "$ref": "#/texts/583" + }, + { + "$ref": "#/texts/584" + }, + { + "$ref": "#/texts/585" + }, + { + "$ref": "#/texts/586" + }, + { + "$ref": "#/texts/587" + }, + { + "$ref": "#/texts/588" + }, + { + "$ref": "#/texts/589" + }, + { + "$ref": "#/texts/590" + }, + { + "$ref": "#/texts/591" + }, + { + "$ref": "#/texts/592" + }, + { + "$ref": "#/texts/593" + }, + { + "$ref": "#/texts/594" + }, + { + "$ref": "#/texts/595" + }, + { + "$ref": "#/texts/596" + }, + { + "$ref": "#/texts/597" + }, + { + "$ref": "#/texts/598" + }, + { + "$ref": "#/texts/599" + }, + { + "$ref": "#/texts/600" + }, + { + "$ref": "#/texts/601" + }, + { + "$ref": "#/texts/602" + }, + { + "$ref": "#/texts/603" + }, + { + "$ref": "#/texts/604" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/138", + "parent": { + "$ref": "#/texts/569" + }, + "children": [ + { + "$ref": "#/texts/606" + }, + { + "$ref": "#/texts/607" + }, + { + "$ref": "#/texts/608" + }, + { + "$ref": "#/texts/609" + }, + { + "$ref": "#/texts/610" + }, + { + "$ref": "#/texts/611" + }, + { + "$ref": "#/texts/612" + }, + { + "$ref": "#/texts/613" + }, + { + "$ref": "#/texts/614" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/139", + "parent": { + "$ref": "#/texts/616" + }, + "children": [ + { + "$ref": "#/texts/618" + }, + { + "$ref": "#/texts/619" + }, + { + "$ref": "#/texts/620" + }, + { + "$ref": "#/texts/621" + }, + { + "$ref": "#/texts/622" + }, + { + "$ref": "#/texts/623" + }, + { + "$ref": "#/texts/624" + }, + { + "$ref": "#/texts/625" + }, + { + "$ref": "#/texts/626" + }, + { + "$ref": "#/texts/627" + }, + { + "$ref": "#/texts/628" + }, + { + "$ref": "#/texts/629" + }, + { + "$ref": "#/texts/630" + }, + { + "$ref": "#/texts/631" + }, + { + "$ref": "#/texts/632" + }, + { + "$ref": "#/texts/633" + }, + { + "$ref": "#/texts/634" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/140", + "parent": { + "$ref": "#/texts/635" + }, + "children": [ + { + "$ref": "#/texts/636" + }, + { + "$ref": "#/texts/637" + }, + { + "$ref": "#/texts/638" + }, + { + "$ref": "#/texts/639" + }, + { + "$ref": "#/texts/640" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/141", + "parent": { + "$ref": "#/texts/641" + }, + "children": [ + { + "$ref": "#/texts/642" + }, + { + "$ref": "#/texts/643" + }, + { + "$ref": "#/texts/644" + }, + { + "$ref": "#/texts/645" + }, + { + "$ref": "#/texts/646" + }, + { + "$ref": "#/texts/647" + }, + { + "$ref": "#/texts/648" + }, + { + "$ref": "#/texts/649" + }, + { + "$ref": "#/texts/650" + }, + { + "$ref": "#/texts/651" + }, + { + "$ref": "#/texts/652" + }, + { + "$ref": "#/texts/653" + }, + { + "$ref": "#/texts/654" + }, + { + "$ref": "#/texts/655" + }, + { + "$ref": "#/texts/656" + }, + { + "$ref": "#/texts/657" + }, + { + "$ref": "#/texts/658" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/142", + "parent": { + "$ref": "#/texts/641" + }, + "children": [ + { + "$ref": "#/texts/659" + }, + { + "$ref": "#/texts/660" + }, + { + "$ref": "#/texts/661" + }, + { + "$ref": "#/texts/662" + }, + { + "$ref": "#/texts/663" + }, + { + "$ref": "#/texts/664" + }, + { + "$ref": "#/texts/665" + }, + { + "$ref": "#/texts/666" + }, + { + "$ref": "#/texts/667" + }, + { + "$ref": "#/texts/668" + }, + { + "$ref": "#/texts/669" + }, + { + "$ref": "#/texts/670" + }, + { + "$ref": "#/texts/671" + }, + { + "$ref": "#/texts/672" + }, + { + "$ref": "#/texts/673" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/143", + "parent": { + "$ref": "#/texts/674" + }, + "children": [ + { + "$ref": "#/texts/675" + }, + { + "$ref": "#/texts/676" + }, + { + "$ref": "#/texts/677" + }, + { + "$ref": "#/texts/678" + }, + { + "$ref": "#/texts/679" + }, + { + "$ref": "#/texts/680" + }, + { + "$ref": "#/texts/681" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/144", + "parent": { + "$ref": "#/texts/684" + }, + "children": [ + { + "$ref": "#/texts/685" + }, + { + "$ref": "#/texts/686" + }, + { + "$ref": "#/texts/687" + }, + { + "$ref": "#/texts/688" + }, + { + "$ref": "#/texts/689" + }, + { + "$ref": "#/texts/690" + }, + { + "$ref": "#/texts/691" + }, + { + "$ref": "#/texts/692" + }, + { + "$ref": "#/texts/693" + }, + { + "$ref": "#/texts/694" + }, + { + "$ref": "#/texts/695" + }, + { + "$ref": "#/texts/696" + }, + { + "$ref": "#/texts/697" + }, + { + "$ref": "#/texts/698" + }, + { + "$ref": "#/texts/699" + }, + { + "$ref": "#/texts/700" + }, + { + "$ref": "#/texts/701" + }, + { + "$ref": "#/texts/702" + }, + { + "$ref": "#/texts/703" + }, + { + "$ref": "#/texts/704" + }, + { + "$ref": "#/texts/705" + }, + { + "$ref": "#/texts/706" + }, + { + "$ref": "#/texts/707" + }, + { + "$ref": "#/texts/708" + }, + { + "$ref": "#/texts/709" + }, + { + "$ref": "#/texts/710" + }, + { + "$ref": "#/texts/711" + }, + { + "$ref": "#/texts/712" + }, + { + "$ref": "#/texts/713" + }, + { + "$ref": "#/texts/714" + }, + { + "$ref": "#/texts/715" + }, + { + "$ref": "#/texts/716" + }, + { + "$ref": "#/texts/717" + }, + { + "$ref": "#/texts/718" + }, + { + "$ref": "#/texts/719" + }, + { + "$ref": "#/texts/720" + }, + { + "$ref": "#/texts/721" + }, + { + "$ref": "#/texts/722" + }, + { + "$ref": "#/texts/723" + }, + { + "$ref": "#/texts/724" + }, + { + "$ref": "#/texts/725" + }, + { + "$ref": "#/texts/726" + }, + { + "$ref": "#/texts/727" + }, + { + "$ref": "#/texts/728" + }, + { + "$ref": "#/texts/729" + }, + { + "$ref": "#/texts/730" + }, + { + "$ref": "#/texts/731" + }, + { + "$ref": "#/texts/732" + }, + { + "$ref": "#/texts/733" + }, + { + "$ref": "#/texts/734" + }, + { + "$ref": "#/texts/735" + }, + { + "$ref": "#/texts/736" + }, + { + "$ref": "#/texts/737" + }, + { + "$ref": "#/texts/738" + }, + { + "$ref": "#/texts/739" + }, + { + "$ref": "#/texts/740" + }, + { + "$ref": "#/texts/741" + }, + { + "$ref": "#/texts/742" + }, + { + "$ref": "#/texts/743" + }, + { + "$ref": "#/texts/744" + }, + { + "$ref": "#/texts/745" + }, + { + "$ref": "#/texts/746" + }, + { + "$ref": "#/texts/747" + }, + { + "$ref": "#/texts/748" + }, + { + "$ref": "#/texts/749" + }, + { + "$ref": "#/texts/750" + }, + { + "$ref": "#/texts/751" + }, + { + "$ref": "#/texts/752" + }, + { + "$ref": "#/texts/753" + }, + { + "$ref": "#/texts/754" + }, + { + "$ref": "#/texts/755" + }, + { + "$ref": "#/texts/756" + }, + { + "$ref": "#/texts/757" + }, + { + "$ref": "#/texts/758" + }, + { + "$ref": "#/texts/759" + }, + { + "$ref": "#/texts/760" + } + ], + "content_layer": "body", + "name": "list", + "label": "list" + } + ], + "texts": [ + { + "self_ref": "#/texts/0", + "parent": { + "$ref": "#/body" + }, + "children": [ + { + "$ref": "#/texts/1" + }, + { + "$ref": "#/texts/2" + }, + { + "$ref": "#/texts/3" + }, + { + "$ref": "#/texts/27" + }, + { + "$ref": "#/texts/43" + }, + { + "$ref": "#/texts/469" + }, + { + "$ref": "#/texts/674" + }, + { + "$ref": "#/texts/682" + }, + { + "$ref": "#/texts/684" + } + ], + "content_layer": "body", + "label": "title", + "prov": [], + "orig": "Potential to reduce greenhouse gas emissions through different dairy cattle systems in subtropical regions", + "text": "Potential to reduce greenhouse gas emissions through different dairy cattle systems in subtropical regions" + }, + { + "self_ref": "#/texts/1", + "parent": { + "$ref": "#/texts/0" + }, + "children": [], + "content_layer": "body", + "label": "paragraph", + "prov": [], + "orig": "Henrique M. N. Ribeiro-Filho, Maurício Civiero, Ermias Kebreab", + "text": "Henrique M. N. Ribeiro-Filho, Maurício Civiero, Ermias Kebreab" + }, + { + "self_ref": "#/texts/2", + "parent": { + "$ref": "#/texts/0" + }, + "children": [], + "content_layer": "body", + "label": "paragraph", + "prov": [], + "orig": "Department of Animal Science, University of California, Davis, California, United States of America; Programa de Pós-graduação em Ciência Animal, Universidade do Estado de Santa Catarina, Lages, Santa Catarina, Brazil", + "text": "Department of Animal Science, University of California, Davis, California, United States of America; Programa de Pós-graduação em Ciência Animal, Universidade do Estado de Santa Catarina, Lages, Santa Catarina, Brazil" + }, + { + "self_ref": "#/texts/3", + "parent": { + "$ref": "#/texts/0" + }, + "children": [ + { + "$ref": "#/groups/0" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Abstract", + "text": "Abstract", + "level": 1 + }, + { + "self_ref": "#/texts/4", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Carbon (C) footprint of dairy production, expressed in kg C dioxide (CO", + "text": "Carbon (C) footprint of dairy production, expressed in kg C dioxide (CO" + }, + { + "self_ref": "#/texts/5", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/6", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ") equivalents (CO", + "text": ") equivalents (CO" + }, + { + "self_ref": "#/texts/7", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/8", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e) (kg energy-corrected milk (ECM))", + "text": "e) (kg energy-corrected milk (ECM))" + }, + { + "self_ref": "#/texts/9", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/10", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ", encompasses emissions from feed production, diet management and total product output. The proportion of pasture on diets may affect all these factors, mainly in subtropical climate zones, where cows may access tropical and temperate pastures during warm and cold seasons, respectively. The aim of the study was to assess the C footprint of a dairy system with annual tropical and temperate pastures in a subtropical region. The system boundary included all processes up to the animal farm gate. Feed requirement during the entire life of each cow was based on data recorded from Holstein × Jersey cow herds producing an average of 7,000 kg ECM lactation", + "text": ", encompasses emissions from feed production, diet management and total product output. The proportion of pasture on diets may affect all these factors, mainly in subtropical climate zones, where cows may access tropical and temperate pastures during warm and cold seasons, respectively. The aim of the study was to assess the C footprint of a dairy system with annual tropical and temperate pastures in a subtropical region. The system boundary included all processes up to the animal farm gate. Feed requirement during the entire life of each cow was based on data recorded from Holstein × Jersey cow herds producing an average of 7,000 kg ECM lactation" + }, + { + "self_ref": "#/texts/11", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/12", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ". The milk production response as consequence of feed strategies (scenarios) was based on results from two experiments (warm and cold seasons) using lactating cows from the same herd. Three scenarios were evaluated: total mixed ration (TMR)", + "text": ". The milk production response as consequence of feed strategies (scenarios) was based on results from two experiments (warm and cold seasons) using lactating cows from the same herd. Three scenarios were evaluated: total mixed ration (TMR)" + }, + { + "self_ref": "#/texts/13", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/14", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "intake, 75, and 50% of", + "text": "intake, 75, and 50% of" + }, + { + "self_ref": "#/texts/15", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/16", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "TMR intake with access to grazing either a tropical or temperate pasture during lactation periods. Considering IPCC and international literature values to estimate emissions from urine/dung, feed production and electricity, the C footprint was similar between scenarios, averaging 1.06 kg CO", + "text": "TMR intake with access to grazing either a tropical or temperate pasture during lactation periods. Considering IPCC and international literature values to estimate emissions from urine/dung, feed production and electricity, the C footprint was similar between scenarios, averaging 1.06 kg CO" + }, + { + "self_ref": "#/texts/17", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/18", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg ECM)", + "text": "e (kg ECM)" + }, + { + "self_ref": "#/texts/19", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/20", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ". Considering factors from studies conducted in subtropical conditions and actual inputs for on-farm feed production, the C footprint decreased 0.04 kg CO", + "text": ". Considering factors from studies conducted in subtropical conditions and actual inputs for on-farm feed production, the C footprint decreased 0.04 kg CO" + }, + { + "self_ref": "#/texts/21", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/22", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg ECM)", + "text": "e (kg ECM)" + }, + { + "self_ref": "#/texts/23", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/24", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "in scenarios including pastures compared to", + "text": "in scenarios including pastures compared to" + }, + { + "self_ref": "#/texts/25", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/26", + "parent": { + "$ref": "#/groups/0" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "TMR. Regardless of factors considered, emissions from feed production decreased as the proportion of pasture went up. In conclusion, decreasing TMR intake and including pastures in dairy cow diets in subtropical conditions have the potential to maintain or reduce the C footprint to a small extent.", + "text": "TMR. Regardless of factors considered, emissions from feed production decreased as the proportion of pasture went up. In conclusion, decreasing TMR intake and including pastures in dairy cow diets in subtropical conditions have the potential to maintain or reduce the C footprint to a small extent." + }, + { + "self_ref": "#/texts/27", + "parent": { + "$ref": "#/texts/0" + }, + "children": [ + { + "$ref": "#/groups/1" + }, + { + "$ref": "#/groups/2" + }, + { + "$ref": "#/texts/40" + }, + { + "$ref": "#/texts/41" + }, + { + "$ref": "#/texts/42" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Introduction", + "text": "Introduction", + "level": 1 + }, + { + "self_ref": "#/texts/28", + "parent": { + "$ref": "#/groups/1" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Greenhouse gas (GHG) emissions from livestock activities represent 10–12% of global emissions [1], ranging from 5.5–7.5 Gt CO", + "text": "Greenhouse gas (GHG) emissions from livestock activities represent 10–12% of global emissions [1], ranging from 5.5–7.5 Gt CO" + }, + { + "self_ref": "#/texts/29", + "parent": { + "$ref": "#/groups/1" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/30", + "parent": { + "$ref": "#/groups/1" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "equivalents (CO", + "text": "equivalents (CO" + }, + { + "self_ref": "#/texts/31", + "parent": { + "$ref": "#/groups/1" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/32", + "parent": { + "$ref": "#/groups/1" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e) yr", + "text": "e) yr" + }, + { + "self_ref": "#/texts/33", + "parent": { + "$ref": "#/groups/1" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/34", + "parent": { + "$ref": "#/groups/1" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ", with almost 30% coming from dairy cattle production systems [2]. However, the livestock sector supply between 13 and 17% of calories and between 28 and 33% of human edible protein consumption globally [3]. Additionally, livestock produce more human-edible protein per unit area than crops when land is unsuitable for food crop production [4].", + "text": ", with almost 30% coming from dairy cattle production systems [2]. However, the livestock sector supply between 13 and 17% of calories and between 28 and 33% of human edible protein consumption globally [3]. Additionally, livestock produce more human-edible protein per unit area than crops when land is unsuitable for food crop production [4]." + }, + { + "self_ref": "#/texts/35", + "parent": { + "$ref": "#/groups/2" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Considering the key role of livestock systems in global food security, several technical and management interventions have been investigated to mitigate methane (CH", + "text": "Considering the key role of livestock systems in global food security, several technical and management interventions have been investigated to mitigate methane (CH" + }, + { + "self_ref": "#/texts/36", + "parent": { + "$ref": "#/groups/2" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "4", + "text": "4", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/37", + "parent": { + "$ref": "#/groups/2" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ") emissions from enteric fermentation [5], animal management [6] and manure management [7]. CH", + "text": ") emissions from enteric fermentation [5], animal management [6] and manure management [7]. CH" + }, + { + "self_ref": "#/texts/38", + "parent": { + "$ref": "#/groups/2" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "4", + "text": "4", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/39", + "parent": { + "$ref": "#/groups/2" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "emissions from enteric fermentation represents around 34% of total emissions from livestock sector, which is the largest source [2]. Increasing proportions of concentrate and digestibility of forages in the diet have been proposed as mitigation strategies [1,5]. In contrast, some life cycle assessment (LCA) studies of dairy systems in temperate regions [8–11] have identified that increasing concentrate proportion may increase carbon (C) footprint due to greater resource use and pollutants from the production of feed compared to forage. Thus, increasing pasture proportion on dairy cattle systems may be an alternative management to mitigate the C footprint.", + "text": "emissions from enteric fermentation represents around 34% of total emissions from livestock sector, which is the largest source [2]. Increasing proportions of concentrate and digestibility of forages in the diet have been proposed as mitigation strategies [1,5]. In contrast, some life cycle assessment (LCA) studies of dairy systems in temperate regions [8–11] have identified that increasing concentrate proportion may increase carbon (C) footprint due to greater resource use and pollutants from the production of feed compared to forage. Thus, increasing pasture proportion on dairy cattle systems may be an alternative management to mitigate the C footprint." + }, + { + "self_ref": "#/texts/40", + "parent": { + "$ref": "#/texts/27" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "In subtropical climate zones, cows may graze tropical pastures rather than temperate pastures during the warm season [12]. Some important dairy production areas, such as southern Brazil, central to northern Argentina, Uruguay, South Africa, New Zealand and Australia, are located in these climate zones, having more than 900 million ha in native, permanent or temporary pastures, producing almost 20% of global milk production [13]. However, due to a considerable inter-annual variation in pasture growth rates [14,15], the interest in mixed systems, using total mixed ration (TMR) + pasture has been increasing [16]. Nevertheless, to our best knowledge, studies conducted to evaluate milk production response in dairy cow diets receiving TMR and pastures have only been conducted in temperate pastures and not in tropical pastures (e.g. [17–19]).", + "text": "In subtropical climate zones, cows may graze tropical pastures rather than temperate pastures during the warm season [12]. Some important dairy production areas, such as southern Brazil, central to northern Argentina, Uruguay, South Africa, New Zealand and Australia, are located in these climate zones, having more than 900 million ha in native, permanent or temporary pastures, producing almost 20% of global milk production [13]. However, due to a considerable inter-annual variation in pasture growth rates [14,15], the interest in mixed systems, using total mixed ration (TMR) + pasture has been increasing [16]. Nevertheless, to our best knowledge, studies conducted to evaluate milk production response in dairy cow diets receiving TMR and pastures have only been conducted in temperate pastures and not in tropical pastures (e.g. [17–19])." + }, + { + "self_ref": "#/texts/41", + "parent": { + "$ref": "#/texts/27" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "It has been shown that dairy cows receiving TMR-based diets may not decrease milk production when supplemented with temperate pastures in a vegetative growth stage [18]. On the other hand, tropical pastures have lower organic matter digestibility and cows experience reduced dry matter (DM) intake and milk yield compared to temperate pastures [20,21]. A lower milk yield increases the C footprint intensity [22], offsetting an expected advantage through lower GHG emissions from crop and reduced DM intake.", + "text": "It has been shown that dairy cows receiving TMR-based diets may not decrease milk production when supplemented with temperate pastures in a vegetative growth stage [18]. On the other hand, tropical pastures have lower organic matter digestibility and cows experience reduced dry matter (DM) intake and milk yield compared to temperate pastures [20,21]. A lower milk yield increases the C footprint intensity [22], offsetting an expected advantage through lower GHG emissions from crop and reduced DM intake." + }, + { + "self_ref": "#/texts/42", + "parent": { + "$ref": "#/texts/27" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "The aim of this work was to quantify the C footprint and land use of dairy systems using cows with a medium milk production potential in a subtropical region. The effect of replacing total mixed ration (TMR) with pastures during lactation periods was evaluated.", + "text": "The aim of this work was to quantify the C footprint and land use of dairy systems using cows with a medium milk production potential in a subtropical region. The effect of replacing total mixed ration (TMR) with pastures during lactation periods was evaluated." + }, + { + "self_ref": "#/texts/43", + "parent": { + "$ref": "#/texts/0" + }, + "children": [ + { + "$ref": "#/groups/3" + }, + { + "$ref": "#/texts/47" + }, + { + "$ref": "#/texts/50" + }, + { + "$ref": "#/texts/56" + }, + { + "$ref": "#/texts/75" + }, + { + "$ref": "#/texts/95" + }, + { + "$ref": "#/texts/321" + }, + { + "$ref": "#/texts/337" + }, + { + "$ref": "#/texts/385" + }, + { + "$ref": "#/texts/455" + }, + { + "$ref": "#/texts/467" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Materials and methods", + "text": "Materials and methods", + "level": 1 + }, + { + "self_ref": "#/texts/44", + "parent": { + "$ref": "#/groups/3" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "An LCA was developed according to the ISO standards [23,24] and Food and Agriculture Organization of the United Nations (FAO) Livestock Environmental Assessment Protocol guidelines [25]. All procedures were approved by the ‘Comissão de Ética no Uso de Animais’ (CEUA/UDESC) on September 15, 2016—Approval number 4373090816 -", + "text": "An LCA was developed according to the ISO standards [23,24] and Food and Agriculture Organization of the United Nations (FAO) Livestock Environmental Assessment Protocol guidelines [25]. All procedures were approved by the ‘Comissão de Ética no Uso de Animais’ (CEUA/UDESC) on September 15, 2016—Approval number 4373090816 -" + }, + { + "self_ref": "#/texts/45", + "parent": { + "$ref": "#/groups/3" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "https://www.udesc.br/cav/ceua", + "text": "https://www.udesc.br/cav/ceua", + "hyperlink": "https://www.udesc.br/cav/ceua" + }, + { + "self_ref": "#/texts/46", + "parent": { + "$ref": "#/groups/3" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ".", + "text": "." + }, + { + "self_ref": "#/texts/47", + "parent": { + "$ref": "#/texts/43" + }, + "children": [ + { + "$ref": "#/texts/48" + }, + { + "$ref": "#/pictures/0" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "System boundary", + "text": "System boundary", + "level": 2 + }, + { + "self_ref": "#/texts/48", + "parent": { + "$ref": "#/texts/47" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "The goal of the study was to assess the C footprint of annual tropical and temperate pastures in lactating dairy cow diets. The production system was divided into four main processes: (i) animal husbandry, (ii) manure management and urine and dung deposited by grazing animals, (iii) production of feed ingredients and (iv) farm management (Fig 1). The study boundary included all processes up to the animal farm gate (cradle to gate), including secondary sources such as GHG emissions during the production of fuel, electricity, machinery, manufacturing of fertilizer, pesticides, seeds and plastic used in silage production. Fuel combustion and machinery (manufacture and repairs) for manure handling and electricity for milking and confinement were accounted as emissions from farm management. Emissions post milk production were assumed to be similar for all scenarios, therefore, activities including milk processing, distribution, retail or consumption were outside of the system boundary.", + "text": "The goal of the study was to assess the C footprint of annual tropical and temperate pastures in lactating dairy cow diets. The production system was divided into four main processes: (i) animal husbandry, (ii) manure management and urine and dung deposited by grazing animals, (iii) production of feed ingredients and (iv) farm management (Fig 1). The study boundary included all processes up to the animal farm gate (cradle to gate), including secondary sources such as GHG emissions during the production of fuel, electricity, machinery, manufacturing of fertilizer, pesticides, seeds and plastic used in silage production. Fuel combustion and machinery (manufacture and repairs) for manure handling and electricity for milking and confinement were accounted as emissions from farm management. Emissions post milk production were assumed to be similar for all scenarios, therefore, activities including milk processing, distribution, retail or consumption were outside of the system boundary." + }, + { + "self_ref": "#/texts/49", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "caption", + "prov": [], + "orig": "Fig 1 Overview of the milk production system boundary considered in the study.", + "text": "Fig 1 Overview of the milk production system boundary considered in the study." + }, + { + "self_ref": "#/texts/50", + "parent": { + "$ref": "#/texts/43" + }, + "children": [ + { + "$ref": "#/texts/51" + }, + { + "$ref": "#/texts/52" + }, + { + "$ref": "#/tables/0" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Functional unit", + "text": "Functional unit", + "level": 2 + }, + { + "self_ref": "#/texts/51", + "parent": { + "$ref": "#/texts/50" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "The functional unit was one kilogram of energy-corrected milk (ECM) at the farm gate. All processes in the system were calculated based on one kilogram ECM. The ECM was calculated by multiplying milk production by the ratio of the energy content of the milk to the energy content of standard milk with 4% fat and 3.3% true protein according to NRC [20] as follows:", + "text": "The functional unit was one kilogram of energy-corrected milk (ECM) at the farm gate. All processes in the system were calculated based on one kilogram ECM. The ECM was calculated by multiplying milk production by the ratio of the energy content of the milk to the energy content of standard milk with 4% fat and 3.3% true protein according to NRC [20] as follows:" + }, + { + "self_ref": "#/texts/52", + "parent": { + "$ref": "#/texts/50" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ECM = Milk production × (0.0929 × fat% + 0.0588× true protein% + 0.192) / (0.0929 × (4%) + 0.0588 × (3.3%) + 0.192), where fat% and protein% are fat and protein percentages in milk, respectively. The average milk production and composition were recorded from the University of Santa Catarina State (Brazil) herd, considering 165 lactations between 2009 and 2018. The herd is predominantly Holstein × Jersey cows, with key characteristics described in Table 1.", + "text": "ECM = Milk production × (0.0929 × fat% + 0.0588× true protein% + 0.192) / (0.0929 × (4%) + 0.0588 × (3.3%) + 0.192), where fat% and protein% are fat and protein percentages in milk, respectively. The average milk production and composition were recorded from the University of Santa Catarina State (Brazil) herd, considering 165 lactations between 2009 and 2018. The herd is predominantly Holstein × Jersey cows, with key characteristics described in Table 1." + }, + { + "self_ref": "#/texts/53", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "caption", + "prov": [], + "orig": "Table 1 Descriptive characteristics of the herd.", + "text": "Table 1 Descriptive characteristics of the herd." + }, + { + "self_ref": "#/texts/54", + "parent": { + "$ref": "#/groups/5" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg year", + "text": "kg year" + }, + { + "self_ref": "#/texts/55", + "parent": { + "$ref": "#/groups/5" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/56", + "parent": { + "$ref": "#/texts/43" + }, + "children": [ + { + "$ref": "#/groups/6" + }, + { + "$ref": "#/groups/7" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Data sources and livestock system description", + "text": "Data sources and livestock system description", + "level": 2 + }, + { + "self_ref": "#/texts/57", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "The individual feed requirements, as well as the milk production responses based on feed strategies were based on data recorded from the herd described above and two experiments performed using lactating cows from the same herd. Due to the variation on herbage production throughout the year, feed requirements were estimated taking into consideration that livestock systems have a calving period in April, which represents the beginning of fall season in the southern Hemisphere. The experiments have shown a 10% reduction in ECM production in dairy cows that received both 75 and 50% of", + "text": "The individual feed requirements, as well as the milk production responses based on feed strategies were based on data recorded from the herd described above and two experiments performed using lactating cows from the same herd. Due to the variation on herbage production throughout the year, feed requirements were estimated taking into consideration that livestock systems have a calving period in April, which represents the beginning of fall season in the southern Hemisphere. The experiments have shown a 10% reduction in ECM production in dairy cows that received both 75 and 50% of" + }, + { + "self_ref": "#/texts/58", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/59", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "TMR intake with access to grazing a tropical pasture (pearl-millet,", + "text": "TMR intake with access to grazing a tropical pasture (pearl-millet," + }, + { + "self_ref": "#/texts/60", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Pennisetum glaucum", + "text": "Pennisetum glaucum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/61", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "‘Campeiro’) compared to cows receiving", + "text": "‘Campeiro’) compared to cows receiving" + }, + { + "self_ref": "#/texts/62", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/63", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "TMR intake. Cows grazing on a temperate pasture (ryegrass,", + "text": "TMR intake. Cows grazing on a temperate pasture (ryegrass," + }, + { + "self_ref": "#/texts/64", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Lolium multiflorum", + "text": "Lolium multiflorum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/65", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "‘Maximus’) did not need changes to ECM production compared to the", + "text": "‘Maximus’) did not need changes to ECM production compared to the" + }, + { + "self_ref": "#/texts/66", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/67", + "parent": { + "$ref": "#/groups/6" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "TMR intake group.", + "text": "TMR intake group." + }, + { + "self_ref": "#/texts/68", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Using experimental data, three scenarios were evaluated during the lactation period:", + "text": "Using experimental data, three scenarios were evaluated during the lactation period:" + }, + { + "self_ref": "#/texts/69", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/70", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "TMR intake, and 75, and 50% of", + "text": "TMR intake, and 75, and 50% of" + }, + { + "self_ref": "#/texts/71", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "ad libitum", + "text": "ad libitum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/72", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "TMR intake with access to grazing either an annual tropical or temperate pasture as a function of month ([26], Civiero et al.,", + "text": "TMR intake with access to grazing either an annual tropical or temperate pasture as a function of month ([26], Civiero et al.," + }, + { + "self_ref": "#/texts/73", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "in press", + "text": "in press", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/74", + "parent": { + "$ref": "#/groups/7" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "). From April to October (210 days) cows accessed an annual temperate pasture (ryegrass), and from November to beginning of February (95 days) cows grazed an annual tropical pasture (pearl-millet). The average annual reduction in ECM production in dairy cows with access to pastures is 3%. This value was assumed during an entire lactation period.", + "text": "). From April to October (210 days) cows accessed an annual temperate pasture (ryegrass), and from November to beginning of February (95 days) cows grazed an annual tropical pasture (pearl-millet). The average annual reduction in ECM production in dairy cows with access to pastures is 3%. This value was assumed during an entire lactation period." + }, + { + "self_ref": "#/texts/75", + "parent": { + "$ref": "#/texts/43" + }, + "children": [ + { + "$ref": "#/groups/8" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Impact assessment", + "text": "Impact assessment", + "level": 2 + }, + { + "self_ref": "#/texts/76", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "The CO", + "text": "The CO" + }, + { + "self_ref": "#/texts/77", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/78", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e emissions were calculated by multiplying the emissions of CO", + "text": "e emissions were calculated by multiplying the emissions of CO" + }, + { + "self_ref": "#/texts/79", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/80", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ", CH", + "text": ", CH" + }, + { + "self_ref": "#/texts/81", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "4", + "text": "4", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/82", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "and N", + "text": "and N" + }, + { + "self_ref": "#/texts/83", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/84", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O by their 100-year global warming potential (GWP", + "text": "O by their 100-year global warming potential (GWP" + }, + { + "self_ref": "#/texts/85", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "100", + "text": "100", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/86", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "), based on IPCC assessment report 5 (AR5; [27]). The values of GWP", + "text": "), based on IPCC assessment report 5 (AR5; [27]). The values of GWP" + }, + { + "self_ref": "#/texts/87", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "100", + "text": "100", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/88", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "are 1, 28 and 265 for CO", + "text": "are 1, 28 and 265 for CO" + }, + { + "self_ref": "#/texts/89", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/90", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ", CH", + "text": ", CH" + }, + { + "self_ref": "#/texts/91", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "4", + "text": "4", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/92", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "and N", + "text": "and N" + }, + { + "self_ref": "#/texts/93", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/94", + "parent": { + "$ref": "#/groups/8" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O, respectively.", + "text": "O, respectively." + }, + { + "self_ref": "#/texts/95", + "parent": { + "$ref": "#/texts/43" + }, + "children": [ + { + "$ref": "#/texts/96" + }, + { + "$ref": "#/texts/117" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Feed production", + "text": "Feed production", + "level": 2 + }, + { + "self_ref": "#/texts/96", + "parent": { + "$ref": "#/texts/95" + }, + "children": [ + { + "$ref": "#/groups/9" + }, + { + "$ref": "#/tables/1" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Diets composition", + "text": "Diets composition", + "level": 3 + }, + { + "self_ref": "#/texts/97", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "The DM intake of each ingredient throughout the entire life of animals during lactation periods was calculated for each scenario: cows receiving only TMR, cows receiving 75% of TMR with annual pastures and cows receiving 50% of TMR with annual pastures (Table 2). In each of other phases of life (calf, heifer, dry cow), animals received the same diet, including a perennial tropical pasture (kikuyu grass,", + "text": "The DM intake of each ingredient throughout the entire life of animals during lactation periods was calculated for each scenario: cows receiving only TMR, cows receiving 75% of TMR with annual pastures and cows receiving 50% of TMR with annual pastures (Table 2). In each of other phases of life (calf, heifer, dry cow), animals received the same diet, including a perennial tropical pasture (kikuyu grass," + }, + { + "self_ref": "#/texts/98", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Pennisetum clandestinum", + "text": "Pennisetum clandestinum", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/99", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "). The DM intake of calves, heifers and dry cows was calculated assuming 2.8, 2.5 and 1.9% body weight, respectively [20]. In each case, the actual DM intake of concentrate and corn silage was recorded, and pasture DM intake was estimated by the difference between daily expected DM intake and actual DM intake of concentrate and corn silage. For lactating heifers and cows, TMR was formulated to meet the net energy for lactation (NE", + "text": "). The DM intake of calves, heifers and dry cows was calculated assuming 2.8, 2.5 and 1.9% body weight, respectively [20]. In each case, the actual DM intake of concentrate and corn silage was recorded, and pasture DM intake was estimated by the difference between daily expected DM intake and actual DM intake of concentrate and corn silage. For lactating heifers and cows, TMR was formulated to meet the net energy for lactation (NE" + }, + { + "self_ref": "#/texts/100", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "L", + "text": "L", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/101", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ") and metabolizable protein (MP) requirements of experimental animals, according to [28]. The INRA system was used because it is possible to estimate pasture DM intake taking into account the TMR intake, pasture management and the time of access to pasture using the GrazeIn model [29], which was integrated in the software INRAtion 4.07 (", + "text": ") and metabolizable protein (MP) requirements of experimental animals, according to [28]. The INRA system was used because it is possible to estimate pasture DM intake taking into account the TMR intake, pasture management and the time of access to pasture using the GrazeIn model [29], which was integrated in the software INRAtion 4.07 (" + }, + { + "self_ref": "#/texts/102", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "https://www.inration.educagri.fr/fr/forum.php", + "text": "https://www.inration.educagri.fr/fr/forum.php", + "hyperlink": "https://www.inration.educagri.fr/fr/forum.php" + }, + { + "self_ref": "#/texts/103", + "parent": { + "$ref": "#/groups/9" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "). The nutrient intake was calculated as a product of TMR and pasture intake and the nutrient contents of TMR and pasture, respectively, which were determined in feed samples collected throughout the experiments.", + "text": "). The nutrient intake was calculated as a product of TMR and pasture intake and the nutrient contents of TMR and pasture, respectively, which were determined in feed samples collected throughout the experiments." + }, + { + "self_ref": "#/texts/104", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "caption", + "prov": [], + "orig": "Table 2 Dairy cows’ diets in different scenariosa.", + "text": "Table 2 Dairy cows’ diets in different scenariosa." + }, + { + "self_ref": "#/texts/105", + "parent": { + "$ref": "#/groups/11" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "DM intake, kg d", + "text": "DM intake, kg d" + }, + { + "self_ref": "#/texts/106", + "parent": { + "$ref": "#/groups/11" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/107", + "parent": { + "$ref": "#/groups/13" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Ingredients, g (kg DM)", + "text": "Ingredients, g (kg DM)" + }, + { + "self_ref": "#/texts/108", + "parent": { + "$ref": "#/groups/13" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/109", + "parent": { + "$ref": "#/groups/15" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Chemical composition, g (kg DM)", + "text": "Chemical composition, g (kg DM)" + }, + { + "self_ref": "#/texts/110", + "parent": { + "$ref": "#/groups/15" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/111", + "parent": { + "$ref": "#/groups/17" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "NE", + "text": "NE" + }, + { + "self_ref": "#/texts/112", + "parent": { + "$ref": "#/groups/17" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "L", + "text": "L", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/113", + "parent": { + "$ref": "#/groups/17" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ", Mcal (kg DM)", + "text": ", Mcal (kg DM)" + }, + { + "self_ref": "#/texts/114", + "parent": { + "$ref": "#/groups/17" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/115", + "parent": { + "$ref": "#/groups/19" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "MP, g (kg DM)", + "text": "MP, g (kg DM)" + }, + { + "self_ref": "#/texts/116", + "parent": { + "$ref": "#/groups/19" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/117", + "parent": { + "$ref": "#/texts/95" + }, + "children": [ + { + "$ref": "#/groups/20" + }, + { + "$ref": "#/tables/2" + }, + { + "$ref": "#/groups/45" + }, + { + "$ref": "#/tables/3" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "GHG emissions from crop and pasture production", + "text": "GHG emissions from crop and pasture production", + "level": 3 + }, + { + "self_ref": "#/texts/118", + "parent": { + "$ref": "#/groups/20" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "GHG emission factors used for off- and on-farm feed production were based on literature values, and are presented in Table 3. The emission factor used for corn grain is the average of emission factors observed in different levels of synthetic N fertilization [30]. The emission factor used for soybean is based on Brazilian soybean production [31]. The emissions used for corn silage, including feed processing (cutting, crushing and mixing), and annual or perennial grass productions were 3300 and 1500 kg CO", + "text": "GHG emission factors used for off- and on-farm feed production were based on literature values, and are presented in Table 3. The emission factor used for corn grain is the average of emission factors observed in different levels of synthetic N fertilization [30]. The emission factor used for soybean is based on Brazilian soybean production [31]. The emissions used for corn silage, including feed processing (cutting, crushing and mixing), and annual or perennial grass productions were 3300 and 1500 kg CO" + }, + { + "self_ref": "#/texts/119", + "parent": { + "$ref": "#/groups/20" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/120", + "parent": { + "$ref": "#/groups/20" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e ha", + "text": "e ha" + }, + { + "self_ref": "#/texts/121", + "parent": { + "$ref": "#/groups/20" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/122", + "parent": { + "$ref": "#/groups/20" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ", respectively [32]. The DM production (kg ha", + "text": ", respectively [32]. The DM production (kg ha" + }, + { + "self_ref": "#/texts/123", + "parent": { + "$ref": "#/groups/20" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/124", + "parent": { + "$ref": "#/groups/20" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ") of corn silage and pastures were based on regional and locally recorded data [33–36], assuming that animals are able to consume 70% of pastures during grazing.", + "text": ") of corn silage and pastures were based on regional and locally recorded data [33–36], assuming that animals are able to consume 70% of pastures during grazing." + }, + { + "self_ref": "#/texts/125", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "caption", + "prov": [], + "orig": "Table 3 GHG emission factors for Off- and On-farm feed production.", + "text": "Table 3 GHG emission factors for Off- and On-farm feed production." + }, + { + "self_ref": "#/texts/126", + "parent": { + "$ref": "#/groups/22" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "DM yield (kg ha", + "text": "DM yield (kg ha" + }, + { + "self_ref": "#/texts/127", + "parent": { + "$ref": "#/groups/22" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/128", + "parent": { + "$ref": "#/groups/22" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ")", + "text": ")" + }, + { + "self_ref": "#/texts/129", + "parent": { + "$ref": "#/groups/24" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Unit", + "text": "Unit" + }, + { + "self_ref": "#/texts/130", + "parent": { + "$ref": "#/groups/24" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "a", + "text": "a", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/131", + "parent": { + "$ref": "#/groups/26" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg CO", + "text": "kg CO" + }, + { + "self_ref": "#/texts/132", + "parent": { + "$ref": "#/groups/26" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/133", + "parent": { + "$ref": "#/groups/26" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg grain)", + "text": "e (kg grain)" + }, + { + "self_ref": "#/texts/134", + "parent": { + "$ref": "#/groups/26" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/135", + "parent": { + "$ref": "#/groups/28" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg CO", + "text": "kg CO" + }, + { + "self_ref": "#/texts/136", + "parent": { + "$ref": "#/groups/28" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/137", + "parent": { + "$ref": "#/groups/28" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg grain)", + "text": "e (kg grain)" + }, + { + "self_ref": "#/texts/138", + "parent": { + "$ref": "#/groups/28" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/139", + "parent": { + "$ref": "#/groups/30" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Corn silage", + "text": "Corn silage" + }, + { + "self_ref": "#/texts/140", + "parent": { + "$ref": "#/groups/30" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "b", + "text": "b", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/141", + "parent": { + "$ref": "#/groups/32" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg CO", + "text": "kg CO" + }, + { + "self_ref": "#/texts/142", + "parent": { + "$ref": "#/groups/32" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/143", + "parent": { + "$ref": "#/groups/32" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg DM)", + "text": "e (kg DM)" + }, + { + "self_ref": "#/texts/144", + "parent": { + "$ref": "#/groups/32" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/145", + "parent": { + "$ref": "#/groups/34" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Annual ryegrass", + "text": "Annual ryegrass" + }, + { + "self_ref": "#/texts/146", + "parent": { + "$ref": "#/groups/34" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "c", + "text": "c", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/147", + "parent": { + "$ref": "#/groups/36" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg CO", + "text": "kg CO" + }, + { + "self_ref": "#/texts/148", + "parent": { + "$ref": "#/groups/36" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/149", + "parent": { + "$ref": "#/groups/36" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg DM)", + "text": "e (kg DM)" + }, + { + "self_ref": "#/texts/150", + "parent": { + "$ref": "#/groups/36" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/151", + "parent": { + "$ref": "#/groups/38" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Pearl millet", + "text": "Pearl millet" + }, + { + "self_ref": "#/texts/152", + "parent": { + "$ref": "#/groups/38" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "d", + "text": "d", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/153", + "parent": { + "$ref": "#/groups/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg CO", + "text": "kg CO" + }, + { + "self_ref": "#/texts/154", + "parent": { + "$ref": "#/groups/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/155", + "parent": { + "$ref": "#/groups/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg DM)", + "text": "e (kg DM)" + }, + { + "self_ref": "#/texts/156", + "parent": { + "$ref": "#/groups/40" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/157", + "parent": { + "$ref": "#/groups/42" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Kikuyu grass", + "text": "Kikuyu grass" + }, + { + "self_ref": "#/texts/158", + "parent": { + "$ref": "#/groups/42" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e", + "text": "e", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/159", + "parent": { + "$ref": "#/groups/44" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg CO", + "text": "kg CO" + }, + { + "self_ref": "#/texts/160", + "parent": { + "$ref": "#/groups/44" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/161", + "parent": { + "$ref": "#/groups/44" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "e (kg DM)", + "text": "e (kg DM)" + }, + { + "self_ref": "#/texts/162", + "parent": { + "$ref": "#/groups/44" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/163", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Emissions from on-farm feed production (corn silage and pasture) were estimated using primary and secondary sources based on the actual amount of each input (Table 4). Primary sources were direct and indirect N", + "text": "Emissions from on-farm feed production (corn silage and pasture) were estimated using primary and secondary sources based on the actual amount of each input (Table 4). Primary sources were direct and indirect N" + }, + { + "self_ref": "#/texts/164", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/165", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O-N emissions from organic and synthetic fertilizers and crop/pasture residues, CO", + "text": "O-N emissions from organic and synthetic fertilizers and crop/pasture residues, CO" + }, + { + "self_ref": "#/texts/166", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/167", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-C emissions from lime and urea applications, as well as fuel combustion. The direct N", + "text": "-C emissions from lime and urea applications, as well as fuel combustion. The direct N" + }, + { + "self_ref": "#/texts/168", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/169", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O-N emission factor (kg (kg N input)", + "text": "O-N emission factor (kg (kg N input)" + }, + { + "self_ref": "#/texts/170", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/171", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ") is based on a local study performed previously [37]. For indirect N", + "text": ") is based on a local study performed previously [37]. For indirect N" + }, + { + "self_ref": "#/texts/172", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/173", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O-N emissions (kg N", + "text": "O-N emissions (kg N" + }, + { + "self_ref": "#/texts/174", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/175", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O-N (kg NH", + "text": "O-N (kg NH" + }, + { + "self_ref": "#/texts/176", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "3", + "text": "3", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/177", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-N + NO", + "text": "-N + NO" + }, + { + "self_ref": "#/texts/178", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "x", + "text": "x", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/179", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ")", + "text": ")" + }, + { + "self_ref": "#/texts/180", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/181", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "), as well as CO", + "text": "), as well as CO" + }, + { + "self_ref": "#/texts/182", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/183", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-C emissions from lime + urea, default values proposed by IPCC [38] were used. For perennial pastures, a C sequestration of 0.57 t ha", + "text": "-C emissions from lime + urea, default values proposed by IPCC [38] were used. For perennial pastures, a C sequestration of 0.57 t ha" + }, + { + "self_ref": "#/texts/184", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/185", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "was used based on a 9-year study conducted in southern Brazil [39]. Due to the use of conventional tillage, no C sequestration was considered for annual pastures. The amount of fuel required was 8.9 (no-tillage) and 14.3 L ha", + "text": "was used based on a 9-year study conducted in southern Brazil [39]. Due to the use of conventional tillage, no C sequestration was considered for annual pastures. The amount of fuel required was 8.9 (no-tillage) and 14.3 L ha" + }, + { + "self_ref": "#/texts/186", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/187", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "(disking) for annual tropical and temperate pastures, respectively [40]. The CO", + "text": "(disking) for annual tropical and temperate pastures, respectively [40]. The CO" + }, + { + "self_ref": "#/texts/188", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/189", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "from fuel combustion was 2.7 kg CO", + "text": "from fuel combustion was 2.7 kg CO" + }, + { + "self_ref": "#/texts/190", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/191", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "L", + "text": "L" + }, + { + "self_ref": "#/texts/192", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/193", + "parent": { + "$ref": "#/groups/45" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "[41]. Secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were estimated using emission factors described by Rotz et al. [42].", + "text": "[41]. Secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were estimated using emission factors described by Rotz et al. [42]." + }, + { + "self_ref": "#/texts/194", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "caption", + "prov": [], + "orig": "Table 4 GHG emissions from On-farm feed production.", + "text": "Table 4 GHG emissions from On-farm feed production." + }, + { + "self_ref": "#/texts/195", + "parent": { + "$ref": "#/groups/47" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "DM yield, kg ha", + "text": "DM yield, kg ha" + }, + { + "self_ref": "#/texts/196", + "parent": { + "$ref": "#/groups/47" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/197", + "parent": { + "$ref": "#/groups/49" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Direct N", + "text": "Direct N" + }, + { + "self_ref": "#/texts/198", + "parent": { + "$ref": "#/groups/49" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/199", + "parent": { + "$ref": "#/groups/49" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O emissions to air", + "text": "O emissions to air" + }, + { + "self_ref": "#/texts/200", + "parent": { + "$ref": "#/groups/51" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "N organic fertilizer, kg ha", + "text": "N organic fertilizer, kg ha" + }, + { + "self_ref": "#/texts/201", + "parent": { + "$ref": "#/groups/51" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/202", + "parent": { + "$ref": "#/groups/51" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "a", + "text": "a", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/203", + "parent": { + "$ref": "#/groups/53" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "N from residual DM, kg ha", + "text": "N from residual DM, kg ha" + }, + { + "self_ref": "#/texts/204", + "parent": { + "$ref": "#/groups/53" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/205", + "parent": { + "$ref": "#/groups/53" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "b", + "text": "b", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/206", + "parent": { + "$ref": "#/groups/55" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Emission fator, kg N", + "text": "Emission fator, kg N" + }, + { + "self_ref": "#/texts/207", + "parent": { + "$ref": "#/groups/55" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/208", + "parent": { + "$ref": "#/groups/55" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O-N (kg N)", + "text": "O-N (kg N)" + }, + { + "self_ref": "#/texts/209", + "parent": { + "$ref": "#/groups/55" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/210", + "parent": { + "$ref": "#/groups/55" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "c", + "text": "c", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, { - "self_ref": "#/texts/0", + "self_ref": "#/texts/211", "parent": { - "$ref": "#/body" + "$ref": "#/groups/57" }, - "children": [ - { - "$ref": "#/texts/1" - }, - { - "$ref": "#/texts/2" - }, - { - "$ref": "#/texts/3" - }, - { - "$ref": "#/texts/27" - }, - { - "$ref": "#/texts/43" - }, - { - "$ref": "#/texts/256" - }, - { - "$ref": "#/texts/461" - }, - { - "$ref": "#/texts/469" - }, - { - "$ref": "#/texts/471" - } - ], + "children": [], "content_layer": "body", - "label": "title", + "label": "text", "prov": [], - "orig": "Potential to reduce greenhouse gas emissions through different dairy cattle systems in subtropical regions", - "text": "Potential to reduce greenhouse gas emissions through different dairy cattle systems in subtropical regions" + "orig": "kg N", + "text": "kg N" }, { - "self_ref": "#/texts/1", + "self_ref": "#/texts/212", "parent": { - "$ref": "#/texts/0" + "$ref": "#/groups/57" }, "children": [], "content_layer": "body", - "label": "paragraph", + "label": "text", "prov": [], - "orig": "Henrique M. N. Ribeiro-Filho, Maurício Civiero, Ermias Kebreab", - "text": "Henrique M. N. Ribeiro-Filho, Maurício Civiero, Ermias Kebreab" + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } }, { - "self_ref": "#/texts/2", + "self_ref": "#/texts/213", "parent": { - "$ref": "#/texts/0" + "$ref": "#/groups/57" }, "children": [], "content_layer": "body", - "label": "paragraph", + "label": "text", "prov": [], - "orig": "Department of Animal Science, University of California, Davis, California, United States of America; Programa de Pós-graduação em Ciência Animal, Universidade do Estado de Santa Catarina, Lages, Santa Catarina, Brazil", - "text": "Department of Animal Science, University of California, Davis, California, United States of America; Programa de Pós-graduação em Ciência Animal, Universidade do Estado de Santa Catarina, Lages, Santa Catarina, Brazil" + "orig": "O ha", + "text": "O ha" }, { - "self_ref": "#/texts/3", + "self_ref": "#/texts/214", "parent": { - "$ref": "#/texts/0" + "$ref": "#/groups/57" }, - "children": [ - { - "$ref": "#/groups/0" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Abstract", - "text": "Abstract", - "level": 1 + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/4", + "self_ref": "#/texts/215", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/57" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Carbon (C) footprint of dairy production, expressed in kg C dioxide (CO", - "text": "Carbon (C) footprint of dairy production, expressed in kg C dioxide (CO" + "orig": "from direct emissions", + "text": "from direct emissions" }, { - "self_ref": "#/texts/5", + "self_ref": "#/texts/216", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/59" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Indirect N", + "text": "Indirect N" + }, + { + "self_ref": "#/texts/217", + "parent": { + "$ref": "#/groups/59" }, "children": [], "content_layer": "body", @@ -2003,28 +7350,40 @@ } }, { - "self_ref": "#/texts/6", + "self_ref": "#/texts/218", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/59" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") equivalents (CO", - "text": ") equivalents (CO" + "orig": "O emissions to air", + "text": "O emissions to air" }, { - "self_ref": "#/texts/7", + "self_ref": "#/texts/219", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/61" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "kg NH", + "text": "kg NH" + }, + { + "self_ref": "#/texts/220", + "parent": { + "$ref": "#/groups/61" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "3", + "text": "3", "formatting": { "bold": false, "italic": false, @@ -2034,52 +7393,52 @@ } }, { - "self_ref": "#/texts/8", + "self_ref": "#/texts/221", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/61" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "e) (kg energy-corrected milk (ECM))", - "text": "e) (kg energy-corrected milk (ECM))" + "orig": "-N+NO", + "text": "-N+NO" }, { - "self_ref": "#/texts/9", + "self_ref": "#/texts/222", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/61" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "x", + "text": "x", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/10", + "self_ref": "#/texts/223", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/61" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ", encompasses emissions from feed production, diet management and total product output. The proportion of pasture on diets may affect all these factors, mainly in subtropical climate zones, where cows may access tropical and temperate pastures during warm and cold seasons, respectively. The aim of the study was to assess the C footprint of a dairy system with annual tropical and temperate pastures in a subtropical region. The system boundary included all processes up to the animal farm gate. Feed requirement during the entire life of each cow was based on data recorded from Holstein × Jersey cow herds producing an average of 7,000 kg ECM lactation", - "text": ", encompasses emissions from feed production, diet management and total product output. The proportion of pasture on diets may affect all these factors, mainly in subtropical climate zones, where cows may access tropical and temperate pastures during warm and cold seasons, respectively. The aim of the study was to assess the C footprint of a dairy system with annual tropical and temperate pastures in a subtropical region. The system boundary included all processes up to the animal farm gate. Feed requirement during the entire life of each cow was based on data recorded from Holstein × Jersey cow herds producing an average of 7,000 kg ECM lactation" + "orig": "-N (kg organic N)", + "text": "-N (kg organic N)" }, { - "self_ref": "#/texts/11", + "self_ref": "#/texts/224", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/61" }, "children": [], "content_layer": "body", @@ -2096,83 +7455,152 @@ } }, { - "self_ref": "#/texts/12", + "self_ref": "#/texts/225", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/61" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ". The milk production response as consequence of feed strategies (scenarios) was based on results from two experiments (warm and cold seasons) using lactating cows from the same herd. Three scenarios were evaluated: total mixed ration (TMR)", - "text": ". The milk production response as consequence of feed strategies (scenarios) was based on results from two experiments (warm and cold seasons) using lactating cows from the same herd. Three scenarios were evaluated: total mixed ration (TMR)" + "orig": "b", + "text": "b", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/13", + "self_ref": "#/texts/226", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/63" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "kg NH", + "text": "kg NH" + }, + { + "self_ref": "#/texts/227", + "parent": { + "$ref": "#/groups/63" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "3", + "text": "3", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "sub" } }, { - "self_ref": "#/texts/14", + "self_ref": "#/texts/228", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/63" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "intake, 75, and 50% of", - "text": "intake, 75, and 50% of" + "orig": "-N+NO", + "text": "-N+NO" }, { - "self_ref": "#/texts/15", + "self_ref": "#/texts/229", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/63" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "x", + "text": "x", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "sub" } }, { - "self_ref": "#/texts/16", + "self_ref": "#/texts/230", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/63" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "TMR intake with access to grazing either a tropical or temperate pasture during lactation periods. Considering IPCC and international literature values to estimate emissions from urine/dung, feed production and electricity, the C footprint was similar between scenarios, averaging 1.06 kg CO", - "text": "TMR intake with access to grazing either a tropical or temperate pasture during lactation periods. Considering IPCC and international literature values to estimate emissions from urine/dung, feed production and electricity, the C footprint was similar between scenarios, averaging 1.06 kg CO" + "orig": "-N (kg synthetic N)", + "text": "-N (kg synthetic N)" }, { - "self_ref": "#/texts/17", + "self_ref": "#/texts/231", + "parent": { + "$ref": "#/groups/63" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/232", + "parent": { + "$ref": "#/groups/63" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "b", + "text": "b", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/233", + "parent": { + "$ref": "#/groups/65" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "kg N", + "text": "kg N" + }, + { + "self_ref": "#/texts/234", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", @@ -2189,59 +7617,59 @@ } }, { - "self_ref": "#/texts/18", + "self_ref": "#/texts/235", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "e (kg ECM)", - "text": "e (kg ECM)" + "orig": "O-N (kg NH", + "text": "O-N (kg NH" }, { - "self_ref": "#/texts/19", + "self_ref": "#/texts/236", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "3", + "text": "3", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/20", + "self_ref": "#/texts/237", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ". Considering factors from studies conducted in subtropical conditions and actual inputs for on-farm feed production, the C footprint decreased 0.04 kg CO", - "text": ". Considering factors from studies conducted in subtropical conditions and actual inputs for on-farm feed production, the C footprint decreased 0.04 kg CO" + "orig": "-N+NO", + "text": "-N+NO" }, { - "self_ref": "#/texts/21", + "self_ref": "#/texts/238", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "x", + "text": "x", "formatting": { "bold": false, "italic": false, @@ -2251,21 +7679,21 @@ } }, { - "self_ref": "#/texts/22", + "self_ref": "#/texts/239", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "e (kg ECM)", - "text": "e (kg ECM)" + "orig": "-N)", + "text": "-N)" }, { - "self_ref": "#/texts/23", + "self_ref": "#/texts/240", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", @@ -2282,131 +7710,109 @@ } }, { - "self_ref": "#/texts/24", - "parent": { - "$ref": "#/groups/0" - }, - "children": [], - "content_layer": "body", - "label": "text", - "prov": [], - "orig": "in scenarios including pastures compared to", - "text": "in scenarios including pastures compared to" - }, - { - "self_ref": "#/texts/25", + "self_ref": "#/texts/241", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/65" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "b", + "text": "b", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "super" } }, { - "self_ref": "#/texts/26", + "self_ref": "#/texts/242", "parent": { - "$ref": "#/groups/0" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "TMR. Regardless of factors considered, emissions from feed production decreased as the proportion of pasture went up. In conclusion, decreasing TMR intake and including pastures in dairy cow diets in subtropical conditions have the potential to maintain or reduce the C footprint to a small extent.", - "text": "TMR. Regardless of factors considered, emissions from feed production decreased as the proportion of pasture went up. In conclusion, decreasing TMR intake and including pastures in dairy cow diets in subtropical conditions have the potential to maintain or reduce the C footprint to a small extent." + "orig": "kg N", + "text": "kg N" }, { - "self_ref": "#/texts/27", + "self_ref": "#/texts/243", "parent": { - "$ref": "#/texts/0" + "$ref": "#/groups/67" }, - "children": [ - { - "$ref": "#/groups/1" - }, - { - "$ref": "#/groups/2" - }, - { - "$ref": "#/texts/40" - }, - { - "$ref": "#/texts/41" - }, - { - "$ref": "#/texts/42" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Introduction", - "text": "Introduction", - "level": 1 + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } }, { - "self_ref": "#/texts/28", + "self_ref": "#/texts/244", "parent": { - "$ref": "#/groups/1" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Greenhouse gas (GHG) emissions from livestock activities represent 10–12% of global emissions [1], ranging from 5.5–7.5 Gt CO", - "text": "Greenhouse gas (GHG) emissions from livestock activities represent 10–12% of global emissions [1], ranging from 5.5–7.5 Gt CO" + "orig": "O ha", + "text": "O ha" }, { - "self_ref": "#/texts/29", + "self_ref": "#/texts/245", "parent": { - "$ref": "#/groups/1" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/30", + "self_ref": "#/texts/246", "parent": { - "$ref": "#/groups/1" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "equivalents (CO", - "text": "equivalents (CO" + "orig": "from NH", + "text": "from NH" }, { - "self_ref": "#/texts/31", + "self_ref": "#/texts/247", "parent": { - "$ref": "#/groups/1" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "3", + "text": "3", "formatting": { "bold": false, "italic": false, @@ -2416,71 +7822,71 @@ } }, { - "self_ref": "#/texts/32", + "self_ref": "#/texts/248", "parent": { - "$ref": "#/groups/1" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "e) yr", - "text": "e) yr" + "orig": "+NO", + "text": "+NO" }, { - "self_ref": "#/texts/33", + "self_ref": "#/texts/249", "parent": { - "$ref": "#/groups/1" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "x", + "text": "x", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/34", + "self_ref": "#/texts/250", "parent": { - "$ref": "#/groups/1" + "$ref": "#/groups/67" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ", with almost 30% coming from dairy cattle production systems [2]. However, the livestock sector supply between 13 and 17% of calories and between 28 and 33% of human edible protein consumption globally [3]. Additionally, livestock produce more human-edible protein per unit area than crops when land is unsuitable for food crop production [4].", - "text": ", with almost 30% coming from dairy cattle production systems [2]. However, the livestock sector supply between 13 and 17% of calories and between 28 and 33% of human edible protein consumption globally [3]. Additionally, livestock produce more human-edible protein per unit area than crops when land is unsuitable for food crop production [4]." + "orig": "volatilized", + "text": "volatilized" }, { - "self_ref": "#/texts/35", + "self_ref": "#/texts/251", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/69" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Considering the key role of livestock systems in global food security, several technical and management interventions have been investigated to mitigate methane (CH", - "text": "Considering the key role of livestock systems in global food security, several technical and management interventions have been investigated to mitigate methane (CH" + "orig": "Indirect N", + "text": "Indirect N" }, { - "self_ref": "#/texts/36", + "self_ref": "#/texts/252", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/69" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -2490,596 +7896,603 @@ } }, { - "self_ref": "#/texts/37", + "self_ref": "#/texts/253", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/69" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") emissions from enteric fermentation [5], animal management [6] and manure management [7]. CH", - "text": ") emissions from enteric fermentation [5], animal management [6] and manure management [7]. CH" + "orig": "O emissions to soil", + "text": "O emissions to soil" }, { - "self_ref": "#/texts/38", + "self_ref": "#/texts/254", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/71" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", - "formatting": { - "bold": false, - "italic": false, - "underline": false, - "strikethrough": false, - "script": "sub" - } + "orig": "kg N losses by leaching (kg N)", + "text": "kg N losses by leaching (kg N)" }, { - "self_ref": "#/texts/39", + "self_ref": "#/texts/255", "parent": { - "$ref": "#/groups/2" + "$ref": "#/groups/71" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "emissions from enteric fermentation represents around 34% of total emissions from livestock sector, which is the largest source [2]. Increasing proportions of concentrate and digestibility of forages in the diet have been proposed as mitigation strategies [1,5]. In contrast, some life cycle assessment (LCA) studies of dairy systems in temperate regions [8–11] have identified that increasing concentrate proportion may increase carbon (C) footprint due to greater resource use and pollutants from the production of feed compared to forage. Thus, increasing pasture proportion on dairy cattle systems may be an alternative management to mitigate the C footprint.", - "text": "emissions from enteric fermentation represents around 34% of total emissions from livestock sector, which is the largest source [2]. Increasing proportions of concentrate and digestibility of forages in the diet have been proposed as mitigation strategies [1,5]. In contrast, some life cycle assessment (LCA) studies of dairy systems in temperate regions [8–11] have identified that increasing concentrate proportion may increase carbon (C) footprint due to greater resource use and pollutants from the production of feed compared to forage. Thus, increasing pasture proportion on dairy cattle systems may be an alternative management to mitigate the C footprint." + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/40", + "self_ref": "#/texts/256", "parent": { - "$ref": "#/texts/27" + "$ref": "#/groups/71" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "In subtropical climate zones, cows may graze tropical pastures rather than temperate pastures during the warm season [12]. Some important dairy production areas, such as southern Brazil, central to northern Argentina, Uruguay, South Africa, New Zealand and Australia, are located in these climate zones, having more than 900 million ha in native, permanent or temporary pastures, producing almost 20% of global milk production [13]. However, due to a considerable inter-annual variation in pasture growth rates [14,15], the interest in mixed systems, using total mixed ration (TMR) + pasture has been increasing [16]. Nevertheless, to our best knowledge, studies conducted to evaluate milk production response in dairy cow diets receiving TMR and pastures have only been conducted in temperate pastures and not in tropical pastures (e.g. [17–19]).", - "text": "In subtropical climate zones, cows may graze tropical pastures rather than temperate pastures during the warm season [12]. Some important dairy production areas, such as southern Brazil, central to northern Argentina, Uruguay, South Africa, New Zealand and Australia, are located in these climate zones, having more than 900 million ha in native, permanent or temporary pastures, producing almost 20% of global milk production [13]. However, due to a considerable inter-annual variation in pasture growth rates [14,15], the interest in mixed systems, using total mixed ration (TMR) + pasture has been increasing [16]. Nevertheless, to our best knowledge, studies conducted to evaluate milk production response in dairy cow diets receiving TMR and pastures have only been conducted in temperate pastures and not in tropical pastures (e.g. [17–19])." + "orig": "b", + "text": "b", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/41", + "self_ref": "#/texts/257", "parent": { - "$ref": "#/texts/27" + "$ref": "#/groups/73" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "It has been shown that dairy cows receiving TMR-based diets may not decrease milk production when supplemented with temperate pastures in a vegetative growth stage [18]. On the other hand, tropical pastures have lower organic matter digestibility and cows experience reduced dry matter (DM) intake and milk yield compared to temperate pastures [20,21]. A lower milk yield increases the C footprint intensity [22], offsetting an expected advantage through lower GHG emissions from crop and reduced DM intake.", - "text": "It has been shown that dairy cows receiving TMR-based diets may not decrease milk production when supplemented with temperate pastures in a vegetative growth stage [18]. On the other hand, tropical pastures have lower organic matter digestibility and cows experience reduced dry matter (DM) intake and milk yield compared to temperate pastures [20,21]. A lower milk yield increases the C footprint intensity [22], offsetting an expected advantage through lower GHG emissions from crop and reduced DM intake." + "orig": "kg N", + "text": "kg N" }, { - "self_ref": "#/texts/42", + "self_ref": "#/texts/258", "parent": { - "$ref": "#/texts/27" + "$ref": "#/groups/73" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The aim of this work was to quantify the C footprint and land use of dairy systems using cows with a medium milk production potential in a subtropical region. The effect of replacing total mixed ration (TMR) with pastures during lactation periods was evaluated.", - "text": "The aim of this work was to quantify the C footprint and land use of dairy systems using cows with a medium milk production potential in a subtropical region. The effect of replacing total mixed ration (TMR) with pastures during lactation periods was evaluated." - }, - { - "self_ref": "#/texts/43", - "parent": { - "$ref": "#/texts/0" - }, - "children": [ - { - "$ref": "#/groups/3" - }, - { - "$ref": "#/texts/47" - }, - { - "$ref": "#/texts/50" - }, - { - "$ref": "#/texts/54" - }, - { - "$ref": "#/texts/73" - }, - { - "$ref": "#/texts/93" - }, - { - "$ref": "#/texts/144" - }, - { - "$ref": "#/texts/160" - }, - { - "$ref": "#/texts/208" - }, - { - "$ref": "#/texts/242" - }, - { - "$ref": "#/texts/254" - } - ], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/259", + "parent": { + "$ref": "#/groups/73" + }, + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Materials and methods", - "text": "Materials and methods", - "level": 1 + "orig": "O-N (kg N leaching)", + "text": "O-N (kg N leaching)" }, { - "self_ref": "#/texts/44", + "self_ref": "#/texts/260", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/73" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "An LCA was developed according to the ISO standards [23,24] and Food and Agriculture Organization of the United Nations (FAO) Livestock Environmental Assessment Protocol guidelines [25]. All procedures were approved by the ‘Comissão de Ética no Uso de Animais’ (CEUA/UDESC) on September 15, 2016—Approval number 4373090816 -", - "text": "An LCA was developed according to the ISO standards [23,24] and Food and Agriculture Organization of the United Nations (FAO) Livestock Environmental Assessment Protocol guidelines [25]. All procedures were approved by the ‘Comissão de Ética no Uso de Animais’ (CEUA/UDESC) on September 15, 2016—Approval number 4373090816 -" + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/45", + "self_ref": "#/texts/261", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/75" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "https://www.udesc.br/cav/ceua", - "text": "https://www.udesc.br/cav/ceua", - "hyperlink": "https://www.udesc.br/cav/ceua" + "orig": "kg N", + "text": "kg N" }, { - "self_ref": "#/texts/46", + "self_ref": "#/texts/262", "parent": { - "$ref": "#/groups/3" + "$ref": "#/groups/75" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ".", - "text": "." + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } }, { - "self_ref": "#/texts/47", + "self_ref": "#/texts/263", "parent": { - "$ref": "#/texts/43" + "$ref": "#/groups/75" }, - "children": [ - { - "$ref": "#/texts/48" - }, - { - "$ref": "#/pictures/0" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "System boundary", - "text": "System boundary", - "level": 2 + "orig": "O ha", + "text": "O ha" }, { - "self_ref": "#/texts/48", + "self_ref": "#/texts/264", "parent": { - "$ref": "#/texts/47" + "$ref": "#/groups/75" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The goal of the study was to assess the C footprint of annual tropical and temperate pastures in lactating dairy cow diets. The production system was divided into four main processes: (i) animal husbandry, (ii) manure management and urine and dung deposited by grazing animals, (iii) production of feed ingredients and (iv) farm management (Fig 1). The study boundary included all processes up to the animal farm gate (cradle to gate), including secondary sources such as GHG emissions during the production of fuel, electricity, machinery, manufacturing of fertilizer, pesticides, seeds and plastic used in silage production. Fuel combustion and machinery (manufacture and repairs) for manure handling and electricity for milking and confinement were accounted as emissions from farm management. Emissions post milk production were assumed to be similar for all scenarios, therefore, activities including milk processing, distribution, retail or consumption were outside of the system boundary.", - "text": "The goal of the study was to assess the C footprint of annual tropical and temperate pastures in lactating dairy cow diets. The production system was divided into four main processes: (i) animal husbandry, (ii) manure management and urine and dung deposited by grazing animals, (iii) production of feed ingredients and (iv) farm management (Fig 1). The study boundary included all processes up to the animal farm gate (cradle to gate), including secondary sources such as GHG emissions during the production of fuel, electricity, machinery, manufacturing of fertilizer, pesticides, seeds and plastic used in silage production. Fuel combustion and machinery (manufacture and repairs) for manure handling and electricity for milking and confinement were accounted as emissions from farm management. Emissions post milk production were assumed to be similar for all scenarios, therefore, activities including milk processing, distribution, retail or consumption were outside of the system boundary." + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/49", + "self_ref": "#/texts/265", "parent": { - "$ref": "#/body" + "$ref": "#/groups/75" }, "children": [], "content_layer": "body", - "label": "caption", + "label": "text", "prov": [], - "orig": "Fig 1 Overview of the milk production system boundary considered in the study.", - "text": "Fig 1 Overview of the milk production system boundary considered in the study." + "orig": "from N losses by leaching", + "text": "from N losses by leaching" }, { - "self_ref": "#/texts/50", + "self_ref": "#/texts/266", "parent": { - "$ref": "#/texts/43" + "$ref": "#/groups/77" }, - "children": [ - { - "$ref": "#/texts/51" - }, - { - "$ref": "#/texts/52" - }, - { - "$ref": "#/tables/0" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Functional unit", - "text": "Functional unit", - "level": 2 + "orig": "kg N", + "text": "kg N" }, { - "self_ref": "#/texts/51", + "self_ref": "#/texts/267", "parent": { - "$ref": "#/texts/50" + "$ref": "#/groups/77" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The functional unit was one kilogram of energy-corrected milk (ECM) at the farm gate. All processes in the system were calculated based on one kilogram ECM. The ECM was calculated by multiplying milk production by the ratio of the energy content of the milk to the energy content of standard milk with 4% fat and 3.3% true protein according to NRC [20] as follows:", - "text": "The functional unit was one kilogram of energy-corrected milk (ECM) at the farm gate. All processes in the system were calculated based on one kilogram ECM. The ECM was calculated by multiplying milk production by the ratio of the energy content of the milk to the energy content of standard milk with 4% fat and 3.3% true protein according to NRC [20] as follows:" + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } }, { - "self_ref": "#/texts/52", + "self_ref": "#/texts/268", "parent": { - "$ref": "#/texts/50" + "$ref": "#/groups/77" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ECM = Milk production × (0.0929 × fat% + 0.0588× true protein% + 0.192) / (0.0929 × (4%) + 0.0588 × (3.3%) + 0.192), where fat% and protein% are fat and protein percentages in milk, respectively. The average milk production and composition were recorded from the University of Santa Catarina State (Brazil) herd, considering 165 lactations between 2009 and 2018. The herd is predominantly Holstein × Jersey cows, with key characteristics described in Table 1.", - "text": "ECM = Milk production × (0.0929 × fat% + 0.0588× true protein% + 0.192) / (0.0929 × (4%) + 0.0588 × (3.3%) + 0.192), where fat% and protein% are fat and protein percentages in milk, respectively. The average milk production and composition were recorded from the University of Santa Catarina State (Brazil) herd, considering 165 lactations between 2009 and 2018. The herd is predominantly Holstein × Jersey cows, with key characteristics described in Table 1." + "orig": "O ha", + "text": "O ha" }, { - "self_ref": "#/texts/53", + "self_ref": "#/texts/269", "parent": { - "$ref": "#/body" + "$ref": "#/groups/77" }, "children": [], "content_layer": "body", - "label": "caption", + "label": "text", "prov": [], - "orig": "Table 1 Descriptive characteristics of the herd.", - "text": "Table 1 Descriptive characteristics of the herd." + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/54", + "self_ref": "#/texts/270", "parent": { - "$ref": "#/texts/43" + "$ref": "#/groups/77" }, - "children": [ - { - "$ref": "#/groups/4" - }, - { - "$ref": "#/groups/5" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Data sources and livestock system description", - "text": "Data sources and livestock system description", - "level": 2 + "orig": "(direct + indirect emissions)", + "text": "(direct + indirect emissions)" }, { - "self_ref": "#/texts/55", + "self_ref": "#/texts/271", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The individual feed requirements, as well as the milk production responses based on feed strategies were based on data recorded from the herd described above and two experiments performed using lactating cows from the same herd. Due to the variation on herbage production throughout the year, feed requirements were estimated taking into consideration that livestock systems have a calving period in April, which represents the beginning of fall season in the southern Hemisphere. The experiments have shown a 10% reduction in ECM production in dairy cows that received both 75 and 50% of", - "text": "The individual feed requirements, as well as the milk production responses based on feed strategies were based on data recorded from the herd described above and two experiments performed using lactating cows from the same herd. Due to the variation on herbage production throughout the year, feed requirements were estimated taking into consideration that livestock systems have a calving period in April, which represents the beginning of fall season in the southern Hemisphere. The experiments have shown a 10% reduction in ECM production in dairy cows that received both 75 and 50% of" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/56", + "self_ref": "#/texts/272", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "2", + "text": "2", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "sub" } }, { - "self_ref": "#/texts/57", + "self_ref": "#/texts/273", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "TMR intake with access to grazing a tropical pasture (pearl-millet,", - "text": "TMR intake with access to grazing a tropical pasture (pearl-millet," + "orig": "e ha", + "text": "e ha" }, { - "self_ref": "#/texts/58", + "self_ref": "#/texts/274", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Pennisetum glaucum", - "text": "Pennisetum glaucum", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "super" } }, { - "self_ref": "#/texts/59", + "self_ref": "#/texts/275", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "‘Campeiro’) compared to cows receiving", - "text": "‘Campeiro’) compared to cows receiving" + "orig": "from N", + "text": "from N" }, { - "self_ref": "#/texts/60", + "self_ref": "#/texts/276", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "2", + "text": "2", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "sub" } }, { - "self_ref": "#/texts/61", + "self_ref": "#/texts/277", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "TMR intake. Cows grazing on a temperate pasture (ryegrass,", - "text": "TMR intake. Cows grazing on a temperate pasture (ryegrass," + "orig": "0 emissions", + "text": "0 emissions" }, { - "self_ref": "#/texts/62", + "self_ref": "#/texts/278", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/79" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Lolium multiflorum", - "text": "Lolium multiflorum", + "orig": "d", + "text": "d", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "super" } }, { - "self_ref": "#/texts/63", + "self_ref": "#/texts/279", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/81" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "‘Maximus’) did not need changes to ECM production compared to the", - "text": "‘Maximus’) did not need changes to ECM production compared to the" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/64", + "self_ref": "#/texts/280", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/81" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "2", + "text": "2", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "sub" } }, { - "self_ref": "#/texts/65", + "self_ref": "#/texts/281", "parent": { - "$ref": "#/groups/4" + "$ref": "#/groups/81" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "TMR intake group.", - "text": "TMR intake group." + "orig": "ha", + "text": "ha" + }, + { + "self_ref": "#/texts/282", + "parent": { + "$ref": "#/groups/81" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/66", + "self_ref": "#/texts/283", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/81" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Using experimental data, three scenarios were evaluated during the lactation period:", - "text": "Using experimental data, three scenarios were evaluated during the lactation period:" + "orig": "from lime+urea", + "text": "from lime+urea" }, { - "self_ref": "#/texts/67", + "self_ref": "#/texts/284", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/81" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "b", + "text": "b", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "super" } }, { - "self_ref": "#/texts/68", + "self_ref": "#/texts/285", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/83" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "TMR intake, and 75, and 50% of", - "text": "TMR intake, and 75, and 50% of" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/69", + "self_ref": "#/texts/286", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/83" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "ad libitum", - "text": "ad libitum", + "orig": "2", + "text": "2", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "sub" } }, { - "self_ref": "#/texts/70", + "self_ref": "#/texts/287", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/83" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "TMR intake with access to grazing either an annual tropical or temperate pasture as a function of month ([26], Civiero et al.,", - "text": "TMR intake with access to grazing either an annual tropical or temperate pasture as a function of month ([26], Civiero et al.," + "orig": "ha", + "text": "ha" }, { - "self_ref": "#/texts/71", + "self_ref": "#/texts/288", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/83" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "in press", - "text": "in press", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "super" } }, { - "self_ref": "#/texts/72", + "self_ref": "#/texts/289", "parent": { - "$ref": "#/groups/5" + "$ref": "#/groups/83" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "). From April to October (210 days) cows accessed an annual temperate pasture (ryegrass), and from November to beginning of February (95 days) cows grazed an annual tropical pasture (pearl-millet). The average annual reduction in ECM production in dairy cows with access to pastures is 3%. This value was assumed during an entire lactation period.", - "text": "). From April to October (210 days) cows accessed an annual temperate pasture (ryegrass), and from November to beginning of February (95 days) cows grazed an annual tropical pasture (pearl-millet). The average annual reduction in ECM production in dairy cows with access to pastures is 3%. This value was assumed during an entire lactation period." + "orig": "from diesel combustion", + "text": "from diesel combustion" }, { - "self_ref": "#/texts/73", + "self_ref": "#/texts/290", "parent": { - "$ref": "#/texts/43" + "$ref": "#/groups/83" }, - "children": [ - { - "$ref": "#/groups/6" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Impact assessment", - "text": "Impact assessment", - "level": 2 + "orig": "e", + "text": "e", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/74", + "self_ref": "#/texts/291", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/85" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The CO", - "text": "The CO" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/75", + "self_ref": "#/texts/292", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/85" }, "children": [], "content_layer": "body", @@ -3096,59 +8509,59 @@ } }, { - "self_ref": "#/texts/76", + "self_ref": "#/texts/293", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/85" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "e emissions were calculated by multiplying the emissions of CO", - "text": "e emissions were calculated by multiplying the emissions of CO" + "orig": "e from secondary sources", + "text": "e from secondary sources" }, { - "self_ref": "#/texts/77", + "self_ref": "#/texts/294", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/85" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "f", + "text": "f", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/78", + "self_ref": "#/texts/295", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/87" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ", CH", - "text": ", CH" + "orig": "Total CO", + "text": "Total CO" }, { - "self_ref": "#/texts/79", + "self_ref": "#/texts/296", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/87" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -3158,59 +8571,59 @@ } }, { - "self_ref": "#/texts/80", + "self_ref": "#/texts/297", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/87" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "and N", - "text": "and N" + "orig": "e emitted, kg ha", + "text": "e emitted, kg ha" }, { - "self_ref": "#/texts/81", + "self_ref": "#/texts/298", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/87" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/82", + "self_ref": "#/texts/299", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/89" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O by their 100-year global warming potential (GWP", - "text": "O by their 100-year global warming potential (GWP" + "orig": "Emission factor, kg CO", + "text": "Emission factor, kg CO" }, { - "self_ref": "#/texts/83", + "self_ref": "#/texts/300", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/89" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "100", - "text": "100", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -3220,114 +8633,121 @@ } }, { - "self_ref": "#/texts/84", + "self_ref": "#/texts/301", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/89" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "), based on IPCC assessment report 5 (AR5; [27]). The values of GWP", - "text": "), based on IPCC assessment report 5 (AR5; [27]). The values of GWP" + "orig": "e (kg DM)", + "text": "e (kg DM)" }, { - "self_ref": "#/texts/85", + "self_ref": "#/texts/302", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/89" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "100", - "text": "100", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/86", + "self_ref": "#/texts/303", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/89" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "are 1, 28 and 265 for CO", - "text": "are 1, 28 and 265 for CO" + "orig": "g", + "text": "g", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/87", + "self_ref": "#/texts/304", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/91" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", - "formatting": { - "bold": false, - "italic": false, - "underline": false, - "strikethrough": false, - "script": "sub" - } + "orig": "Carbon sequestered, kg ha", + "text": "Carbon sequestered, kg ha" }, { - "self_ref": "#/texts/88", + "self_ref": "#/texts/305", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/91" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ", CH", - "text": ", CH" + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/89", + "self_ref": "#/texts/306", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/91" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "h", + "text": "h", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/90", + "self_ref": "#/texts/307", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/93" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "and N", - "text": "and N" + "orig": "Sequestered CO", + "text": "Sequestered CO" }, { - "self_ref": "#/texts/91", + "self_ref": "#/texts/308", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/93" }, "children": [], "content_layer": "body", @@ -3344,272 +8764,255 @@ } }, { - "self_ref": "#/texts/92", + "self_ref": "#/texts/309", "parent": { - "$ref": "#/groups/6" + "$ref": "#/groups/93" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O, respectively.", - "text": "O, respectively." - }, - { - "self_ref": "#/texts/93", - "parent": { - "$ref": "#/texts/43" - }, - "children": [ - { - "$ref": "#/texts/94" - }, - { - "$ref": "#/texts/103" - } - ], - "content_layer": "body", - "label": "section_header", - "prov": [], - "orig": "Feed production", - "text": "Feed production", - "level": 2 + "orig": "-C, kg ha", + "text": "-C, kg ha" }, { - "self_ref": "#/texts/94", + "self_ref": "#/texts/310", "parent": { - "$ref": "#/texts/93" + "$ref": "#/groups/93" }, - "children": [ - { - "$ref": "#/groups/7" - }, - { - "$ref": "#/tables/1" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Diets composition", - "text": "Diets composition", - "level": 3 + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/95", + "self_ref": "#/texts/311", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/95" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The DM intake of each ingredient throughout the entire life of animals during lactation periods was calculated for each scenario: cows receiving only TMR, cows receiving 75% of TMR with annual pastures and cows receiving 50% of TMR with annual pastures (Table 2). In each of other phases of life (calf, heifer, dry cow), animals received the same diet, including a perennial tropical pasture (kikuyu grass,", - "text": "The DM intake of each ingredient throughout the entire life of animals during lactation periods was calculated for each scenario: cows receiving only TMR, cows receiving 75% of TMR with annual pastures and cows receiving 50% of TMR with annual pastures (Table 2). In each of other phases of life (calf, heifer, dry cow), animals received the same diet, including a perennial tropical pasture (kikuyu grass," + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/96", + "self_ref": "#/texts/312", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/95" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Pennisetum clandestinum", - "text": "Pennisetum clandestinum", + "orig": "2", + "text": "2", "formatting": { "bold": false, - "italic": true, + "italic": false, "underline": false, "strikethrough": false, - "script": "baseline" + "script": "sub" } }, { - "self_ref": "#/texts/97", + "self_ref": "#/texts/313", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/95" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "). The DM intake of calves, heifers and dry cows was calculated assuming 2.8, 2.5 and 1.9% body weight, respectively [20]. In each case, the actual DM intake of concentrate and corn silage was recorded, and pasture DM intake was estimated by the difference between daily expected DM intake and actual DM intake of concentrate and corn silage. For lactating heifers and cows, TMR was formulated to meet the net energy for lactation (NE", - "text": "). The DM intake of calves, heifers and dry cows was calculated assuming 2.8, 2.5 and 1.9% body weight, respectively [20]. In each case, the actual DM intake of concentrate and corn silage was recorded, and pasture DM intake was estimated by the difference between daily expected DM intake and actual DM intake of concentrate and corn silage. For lactating heifers and cows, TMR was formulated to meet the net energy for lactation (NE" + "orig": "e ha", + "text": "e ha" }, { - "self_ref": "#/texts/98", + "self_ref": "#/texts/314", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/95" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "L", - "text": "L", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/99", + "self_ref": "#/texts/315", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/95" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") and metabolizable protein (MP) requirements of experimental animals, according to [28]. The INRA system was used because it is possible to estimate pasture DM intake taking into account the TMR intake, pasture management and the time of access to pasture using the GrazeIn model [29], which was integrated in the software INRAtion 4.07 (", - "text": ") and metabolizable protein (MP) requirements of experimental animals, according to [28]. The INRA system was used because it is possible to estimate pasture DM intake taking into account the TMR intake, pasture management and the time of access to pasture using the GrazeIn model [29], which was integrated in the software INRAtion 4.07 (" + "orig": "(emitted—sequestered)", + "text": "(emitted—sequestered)" }, { - "self_ref": "#/texts/100", + "self_ref": "#/texts/316", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/97" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "https://www.inration.educagri.fr/fr/forum.php", - "text": "https://www.inration.educagri.fr/fr/forum.php", - "hyperlink": "https://www.inration.educagri.fr/fr/forum.php" + "orig": "Emission factor, kg CO", + "text": "Emission factor, kg CO" }, { - "self_ref": "#/texts/101", + "self_ref": "#/texts/317", "parent": { - "$ref": "#/groups/7" + "$ref": "#/groups/97" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "). The nutrient intake was calculated as a product of TMR and pasture intake and the nutrient contents of TMR and pasture, respectively, which were determined in feed samples collected throughout the experiments.", - "text": "). The nutrient intake was calculated as a product of TMR and pasture intake and the nutrient contents of TMR and pasture, respectively, which were determined in feed samples collected throughout the experiments." + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } }, { - "self_ref": "#/texts/102", + "self_ref": "#/texts/318", "parent": { - "$ref": "#/body" + "$ref": "#/groups/97" }, "children": [], "content_layer": "body", - "label": "caption", - "prov": [], - "orig": "Table 2 Dairy cows’ diets in different scenariosa.", - "text": "Table 2 Dairy cows’ diets in different scenariosa." - }, - { - "self_ref": "#/texts/103", - "parent": { - "$ref": "#/texts/93" - }, - "children": [ - { - "$ref": "#/groups/8" - }, - { - "$ref": "#/tables/2" - }, - { - "$ref": "#/groups/9" - }, - { - "$ref": "#/tables/3" - } - ], - "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "GHG emissions from crop and pasture production", - "text": "GHG emissions from crop and pasture production", - "level": 3 + "orig": "e (kg DM)", + "text": "e (kg DM)" }, { - "self_ref": "#/texts/104", + "self_ref": "#/texts/319", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/97" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "GHG emission factors used for off- and on-farm feed production were based on literature values, and are presented in Table 3. The emission factor used for corn grain is the average of emission factors observed in different levels of synthetic N fertilization [30]. The emission factor used for soybean is based on Brazilian soybean production [31]. The emissions used for corn silage, including feed processing (cutting, crushing and mixing), and annual or perennial grass productions were 3300 and 1500 kg CO", - "text": "GHG emission factors used for off- and on-farm feed production were based on literature values, and are presented in Table 3. The emission factor used for corn grain is the average of emission factors observed in different levels of synthetic N fertilization [30]. The emission factor used for soybean is based on Brazilian soybean production [31]. The emissions used for corn silage, including feed processing (cutting, crushing and mixing), and annual or perennial grass productions were 3300 and 1500 kg CO" + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/105", + "self_ref": "#/texts/320", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/97" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "i", + "text": "i", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/106", + "self_ref": "#/texts/321", "parent": { - "$ref": "#/groups/8" + "$ref": "#/texts/43" + }, + "children": [ + { + "$ref": "#/groups/98" + } + ], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Animal husbandry", + "text": "Animal husbandry", + "level": 2 + }, + { + "self_ref": "#/texts/322", + "parent": { + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "e ha", - "text": "e ha" + "orig": "The CH", + "text": "The CH" }, { - "self_ref": "#/texts/107", + "self_ref": "#/texts/323", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "4", + "text": "4", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/108", + "self_ref": "#/texts/324", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ", respectively [32]. The DM production (kg ha", - "text": ", respectively [32]. The DM production (kg ha" + "orig": "emissions from enteric fermentation intensity (g (kg ECM)", + "text": "emissions from enteric fermentation intensity (g (kg ECM)" }, { - "self_ref": "#/texts/109", + "self_ref": "#/texts/325", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", @@ -3626,83 +9029,90 @@ } }, { - "self_ref": "#/texts/110", + "self_ref": "#/texts/326", "parent": { - "$ref": "#/groups/8" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") of corn silage and pastures were based on regional and locally recorded data [33–36], assuming that animals are able to consume 70% of pastures during grazing.", - "text": ") of corn silage and pastures were based on regional and locally recorded data [33–36], assuming that animals are able to consume 70% of pastures during grazing." + "orig": ") was a function of estimated CH", + "text": ") was a function of estimated CH" }, { - "self_ref": "#/texts/111", + "self_ref": "#/texts/327", "parent": { - "$ref": "#/body" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", - "label": "caption", + "label": "text", "prov": [], - "orig": "Table 3 GHG emission factors for Off- and On-farm feed production.", - "text": "Table 3 GHG emission factors for Off- and On-farm feed production." + "orig": "4", + "text": "4", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } }, { - "self_ref": "#/texts/112", + "self_ref": "#/texts/328", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Emissions from on-farm feed production (corn silage and pasture) were estimated using primary and secondary sources based on the actual amount of each input (Table 4). Primary sources were direct and indirect N", - "text": "Emissions from on-farm feed production (corn silage and pasture) were estimated using primary and secondary sources based on the actual amount of each input (Table 4). Primary sources were direct and indirect N" + "orig": "yield (g (kg DM intake)", + "text": "yield (g (kg DM intake)" }, { - "self_ref": "#/texts/113", + "self_ref": "#/texts/329", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/114", + "self_ref": "#/texts/330", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N emissions from organic and synthetic fertilizers and crop/pasture residues, CO", - "text": "O-N emissions from organic and synthetic fertilizers and crop/pasture residues, CO" + "orig": "), actual DM intake and ECM. The enteric CH", + "text": "), actual DM intake and ECM. The enteric CH" }, { - "self_ref": "#/texts/115", + "self_ref": "#/texts/331", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "4", + "text": "4", "formatting": { "bold": false, "italic": false, @@ -3712,28 +9122,28 @@ } }, { - "self_ref": "#/texts/116", + "self_ref": "#/texts/332", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-C emissions from lime and urea applications, as well as fuel combustion. The direct N", - "text": "-C emissions from lime and urea applications, as well as fuel combustion. The direct N" + "orig": "yield was estimated as a function of neutral detergent fiber (NDF) concentration on total DM intake, as proposed by Niu et al. [43], where: CH", + "text": "yield was estimated as a function of neutral detergent fiber (NDF) concentration on total DM intake, as proposed by Niu et al. [43], where: CH" }, { - "self_ref": "#/texts/117", + "self_ref": "#/texts/333", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "4", + "text": "4", "formatting": { "bold": false, "italic": false, @@ -3743,21 +9153,21 @@ } }, { - "self_ref": "#/texts/118", + "self_ref": "#/texts/334", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N emission factor (kg (kg N input)", - "text": "O-N emission factor (kg (kg N input)" + "orig": "yield (g (kg DM intake)", + "text": "yield (g (kg DM intake)" }, { - "self_ref": "#/texts/119", + "self_ref": "#/texts/335", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", @@ -3774,59 +9184,63 @@ } }, { - "self_ref": "#/texts/120", + "self_ref": "#/texts/336", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/98" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") is based on a local study performed previously [37]. For indirect N", - "text": ") is based on a local study performed previously [37]. For indirect N" + "orig": ") = 13.8 + 0.185 × NDF (% DM intake).", + "text": ") = 13.8 + 0.185 × NDF (% DM intake)." }, { - "self_ref": "#/texts/121", + "self_ref": "#/texts/337", "parent": { - "$ref": "#/groups/9" + "$ref": "#/texts/43" }, - "children": [], + "children": [ + { + "$ref": "#/groups/99" + }, + { + "$ref": "#/texts/361" + }, + { + "$ref": "#/groups/100" + } + ], "content_layer": "body", - "label": "text", - "prov": [], - "orig": "2", - "text": "2", - "formatting": { - "bold": false, - "italic": false, - "underline": false, - "strikethrough": false, - "script": "sub" - } + "label": "section_header", + "prov": [], + "orig": "Manure from confined cows and urine and dung from grazing animals", + "text": "Manure from confined cows and urine and dung from grazing animals", + "level": 2 }, { - "self_ref": "#/texts/122", + "self_ref": "#/texts/338", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N emissions (kg N", - "text": "O-N emissions (kg N" + "orig": "The CH", + "text": "The CH" }, { - "self_ref": "#/texts/123", + "self_ref": "#/texts/339", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "4", + "text": "4", "formatting": { "bold": false, "italic": false, @@ -3836,59 +9250,59 @@ } }, { - "self_ref": "#/texts/124", + "self_ref": "#/texts/340", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N (kg NH", - "text": "O-N (kg NH" + "orig": "emission from manure (kg (kg ECM)", + "text": "emission from manure (kg (kg ECM)" }, { - "self_ref": "#/texts/125", + "self_ref": "#/texts/341", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "3", - "text": "3", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/126", + "self_ref": "#/texts/342", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-N + NO", - "text": "-N + NO" + "orig": ") was a function of daily CH", + "text": ") was a function of daily CH" }, { - "self_ref": "#/texts/127", + "self_ref": "#/texts/343", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "x", - "text": "x", + "orig": "4", + "text": "4", "formatting": { "bold": false, "italic": false, @@ -3898,21 +9312,21 @@ } }, { - "self_ref": "#/texts/128", + "self_ref": "#/texts/344", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ")", - "text": ")" + "orig": "emission from manure (kg cow", + "text": "emission from manure (kg cow" }, { - "self_ref": "#/texts/129", + "self_ref": "#/texts/345", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", @@ -3929,83 +9343,83 @@ } }, { - "self_ref": "#/texts/130", + "self_ref": "#/texts/346", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "), as well as CO", - "text": "), as well as CO" + "orig": ") and daily ECM (kg cow", + "text": ") and daily ECM (kg cow" }, { - "self_ref": "#/texts/131", + "self_ref": "#/texts/347", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/132", + "self_ref": "#/texts/348", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-C emissions from lime + urea, default values proposed by IPCC [38] were used. For perennial pastures, a C sequestration of 0.57 t ha", - "text": "-C emissions from lime + urea, default values proposed by IPCC [38] were used. For perennial pastures, a C sequestration of 0.57 t ha" + "orig": "). The daily CH", + "text": "). The daily CH" }, { - "self_ref": "#/texts/133", + "self_ref": "#/texts/349", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "4", + "text": "4", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/134", + "self_ref": "#/texts/350", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "was used based on a 9-year study conducted in southern Brazil [39]. Due to the use of conventional tillage, no C sequestration was considered for annual pastures. The amount of fuel required was 8.9 (no-tillage) and 14.3 L ha", - "text": "was used based on a 9-year study conducted in southern Brazil [39]. Due to the use of conventional tillage, no C sequestration was considered for annual pastures. The amount of fuel required was 8.9 (no-tillage) and 14.3 L ha" + "orig": "emission from manure was estimated according to IPCC [38], which considered daily volatile solid (VS) excreted (kg DM cow", + "text": "emission from manure was estimated according to IPCC [38], which considered daily volatile solid (VS) excreted (kg DM cow" }, { - "self_ref": "#/texts/135", + "self_ref": "#/texts/351", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", @@ -4022,83 +9436,83 @@ } }, { - "self_ref": "#/texts/136", + "self_ref": "#/texts/352", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "(disking) for annual tropical and temperate pastures, respectively [40]. The CO", - "text": "(disking) for annual tropical and temperate pastures, respectively [40]. The CO" + "orig": ") in manure. The daily VS was estimated as proposed by Eugène et al. [44] as: VS = NDOMI + (UE × GE) × (OM/18.45), where: VS = volatile solid excretion on an organic matter (OM) basis (kg day", + "text": ") in manure. The daily VS was estimated as proposed by Eugène et al. [44] as: VS = NDOMI + (UE × GE) × (OM/18.45), where: VS = volatile solid excretion on an organic matter (OM) basis (kg day" }, { - "self_ref": "#/texts/137", + "self_ref": "#/texts/353", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/138", + "self_ref": "#/texts/354", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "from fuel combustion was 2.7 kg CO", - "text": "from fuel combustion was 2.7 kg CO" + "orig": "), NDOMI = non-digestible OM intake (kg day", + "text": "), NDOMI = non-digestible OM intake (kg day" }, { - "self_ref": "#/texts/139", + "self_ref": "#/texts/355", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/140", + "self_ref": "#/texts/356", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "L", - "text": "L" + "orig": "): (1- OM digestibility) × OM intake, UE = urinary energy excretion as a fraction of GE (0.04), GE = gross energy intake (MJ day", + "text": "): (1- OM digestibility) × OM intake, UE = urinary energy excretion as a fraction of GE (0.04), GE = gross energy intake (MJ day" }, { - "self_ref": "#/texts/141", + "self_ref": "#/texts/357", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", @@ -4115,131 +9529,83 @@ } }, { - "self_ref": "#/texts/142", - "parent": { - "$ref": "#/groups/9" - }, - "children": [], - "content_layer": "body", - "label": "text", - "prov": [], - "orig": "[41]. Secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were estimated using emission factors described by Rotz et al. [42].", - "text": "[41]. Secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were estimated using emission factors described by Rotz et al. [42]." - }, - { - "self_ref": "#/texts/143", - "parent": { - "$ref": "#/body" - }, - "children": [], - "content_layer": "body", - "label": "caption", - "prov": [], - "orig": "Table 4 GHG emissions from On-farm feed production.", - "text": "Table 4 GHG emissions from On-farm feed production." - }, - { - "self_ref": "#/texts/144", - "parent": { - "$ref": "#/texts/43" - }, - "children": [ - { - "$ref": "#/groups/10" - } - ], - "content_layer": "body", - "label": "section_header", - "prov": [], - "orig": "Animal husbandry", - "text": "Animal husbandry", - "level": 2 - }, - { - "self_ref": "#/texts/145", + "self_ref": "#/texts/358", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The CH", - "text": "The CH" + "orig": "), OM = organic matter (g), 18.45 = conversion factor for dietary GE per kg of DM (MJ kg", + "text": "), OM = organic matter (g), 18.45 = conversion factor for dietary GE per kg of DM (MJ kg" }, { - "self_ref": "#/texts/146", + "self_ref": "#/texts/359", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/147", + "self_ref": "#/texts/360", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/99" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "emissions from enteric fermentation intensity (g (kg ECM)", - "text": "emissions from enteric fermentation intensity (g (kg ECM)" + "orig": ").", + "text": ")." }, { - "self_ref": "#/texts/148", + "self_ref": "#/texts/361", "parent": { - "$ref": "#/groups/10" + "$ref": "#/texts/337" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", - "formatting": { - "bold": false, - "italic": false, - "underline": false, - "strikethrough": false, - "script": "super" - } + "orig": "The OM digestibility was estimated as a function of chemical composition, using equations published by INRA [21], which takes into account the effects of digestive interactions due to feeding level, the proportion of concentrate and rumen protein balance on OM digestibility. For scenarios where cows had access to grazing, the amount of calculated VS were corrected as a function of the time at pasture. The biodegradability of manure factor (0.13 for dairy cows in Latin America) and methane conversion factor (MCF) values were taken from IPCC [38]. The MCF values for pit storage below animal confinements (> 1 month) were used for the calculation, taking into account the annual average temperature (16.6ºC) or the average temperatures during the growth period of temperate (14.4ºC) or tropical (21ºC) annual pastures, which were 31%, 26% and 46%, respectively.", + "text": "The OM digestibility was estimated as a function of chemical composition, using equations published by INRA [21], which takes into account the effects of digestive interactions due to feeding level, the proportion of concentrate and rumen protein balance on OM digestibility. For scenarios where cows had access to grazing, the amount of calculated VS were corrected as a function of the time at pasture. The biodegradability of manure factor (0.13 for dairy cows in Latin America) and methane conversion factor (MCF) values were taken from IPCC [38]. The MCF values for pit storage below animal confinements (> 1 month) were used for the calculation, taking into account the annual average temperature (16.6ºC) or the average temperatures during the growth period of temperate (14.4ºC) or tropical (21ºC) annual pastures, which were 31%, 26% and 46%, respectively." }, { - "self_ref": "#/texts/149", + "self_ref": "#/texts/362", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") was a function of estimated CH", - "text": ") was a function of estimated CH" + "orig": "The N", + "text": "The N" }, { - "self_ref": "#/texts/150", + "self_ref": "#/texts/363", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -4249,59 +9615,59 @@ } }, { - "self_ref": "#/texts/151", + "self_ref": "#/texts/364", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "yield (g (kg DM intake)", - "text": "yield (g (kg DM intake)" + "orig": "O-N emissions from urine and feces were estimated considering the proportion of N excreted as manure and storage or as urine and dung deposited by grazing animals. These proportions were calculated based on the proportion of daily time that animals stayed on pasture (7 h/24 h = 0.29) or confinement (1−0.29 = 0.71). For lactating heifers and cows, the total amount of N excreted was calculated by the difference between N intake and milk N excretion. For heifers and non-lactating cows, urinary and fecal N excretion were estimated as proposed by Reed et al. [45] (Table 3: equations 10 and 12, respectively). The N", + "text": "O-N emissions from urine and feces were estimated considering the proportion of N excreted as manure and storage or as urine and dung deposited by grazing animals. These proportions were calculated based on the proportion of daily time that animals stayed on pasture (7 h/24 h = 0.29) or confinement (1−0.29 = 0.71). For lactating heifers and cows, the total amount of N excreted was calculated by the difference between N intake and milk N excretion. For heifers and non-lactating cows, urinary and fecal N excretion were estimated as proposed by Reed et al. [45] (Table 3: equations 10 and 12, respectively). The N" }, { - "self_ref": "#/texts/152", + "self_ref": "#/texts/365", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/153", + "self_ref": "#/texts/366", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "), actual DM intake and ECM. The enteric CH", - "text": "), actual DM intake and ECM. The enteric CH" + "orig": "O emissions from stored manure as well as urine and dung during grazing were calculated based on the conversion of N", + "text": "O emissions from stored manure as well as urine and dung during grazing were calculated based on the conversion of N" }, { - "self_ref": "#/texts/154", + "self_ref": "#/texts/367", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -4311,28 +9677,28 @@ } }, { - "self_ref": "#/texts/155", + "self_ref": "#/texts/368", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "yield was estimated as a function of neutral detergent fiber (NDF) concentration on total DM intake, as proposed by Niu et al. [43], where: CH", - "text": "yield was estimated as a function of neutral detergent fiber (NDF) concentration on total DM intake, as proposed by Niu et al. [43], where: CH" + "orig": "O-N emissions to N", + "text": "O-N emissions to N" }, { - "self_ref": "#/texts/156", + "self_ref": "#/texts/369", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -4342,94 +9708,90 @@ } }, { - "self_ref": "#/texts/157", + "self_ref": "#/texts/370", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "yield (g (kg DM intake)", - "text": "yield (g (kg DM intake)" + "orig": "O emissions, where N", + "text": "O emissions, where N" }, { - "self_ref": "#/texts/158", + "self_ref": "#/texts/371", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/159", + "self_ref": "#/texts/372", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") = 13.8 + 0.185 × NDF (% DM intake).", - "text": ") = 13.8 + 0.185 × NDF (% DM intake)." + "orig": "O emissions = N", + "text": "O emissions = N" }, { - "self_ref": "#/texts/160", + "self_ref": "#/texts/373", "parent": { - "$ref": "#/texts/43" + "$ref": "#/groups/100" }, - "children": [ - { - "$ref": "#/groups/11" - }, - { - "$ref": "#/texts/184" - }, - { - "$ref": "#/groups/12" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Manure from confined cows and urine and dung from grazing animals", - "text": "Manure from confined cows and urine and dung from grazing animals", - "level": 2 + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } }, { - "self_ref": "#/texts/161", + "self_ref": "#/texts/374", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The CH", - "text": "The CH" + "orig": "O-N emissions × 44/28. The emission factors were 0.002 kg N", + "text": "O-N emissions × 44/28. The emission factors were 0.002 kg N" }, { - "self_ref": "#/texts/162", + "self_ref": "#/texts/375", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -4439,21 +9801,21 @@ } }, { - "self_ref": "#/texts/163", + "self_ref": "#/texts/376", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "emission from manure (kg (kg ECM)", - "text": "emission from manure (kg (kg ECM)" + "orig": "O-N (kg N)", + "text": "O-N (kg N)" }, { - "self_ref": "#/texts/164", + "self_ref": "#/texts/377", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", @@ -4470,28 +9832,28 @@ } }, { - "self_ref": "#/texts/165", + "self_ref": "#/texts/378", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") was a function of daily CH", - "text": ") was a function of daily CH" + "orig": "stored in a pit below animal confinements, and 0.02 kg N", + "text": "stored in a pit below animal confinements, and 0.02 kg N" }, { - "self_ref": "#/texts/166", + "self_ref": "#/texts/379", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "4", - "text": "4", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, @@ -4501,21 +9863,21 @@ } }, { - "self_ref": "#/texts/167", + "self_ref": "#/texts/380", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "emission from manure (kg cow", - "text": "emission from manure (kg cow" + "orig": "O-N (kg of urine and dung)", + "text": "O-N (kg of urine and dung)" }, { - "self_ref": "#/texts/168", + "self_ref": "#/texts/381", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", @@ -4532,121 +9894,124 @@ } }, { - "self_ref": "#/texts/169", + "self_ref": "#/texts/382", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") and daily ECM (kg cow", - "text": ") and daily ECM (kg cow" + "orig": "deposited on pasture [38]. The indirect N", + "text": "deposited on pasture [38]. The indirect N" }, { - "self_ref": "#/texts/170", + "self_ref": "#/texts/383", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/171", + "self_ref": "#/texts/384", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/100" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "). The daily CH", - "text": "). The daily CH" + "orig": "O emissions from storage manure and urine and dung deposits on pasture were also estimated using the IPCC [38] emission factors.", + "text": "O emissions from storage manure and urine and dung deposits on pasture were also estimated using the IPCC [38] emission factors." }, { - "self_ref": "#/texts/172", + "self_ref": "#/texts/385", "parent": { - "$ref": "#/groups/11" + "$ref": "#/texts/43" }, - "children": [], + "children": [ + { + "$ref": "#/texts/386" + }, + { + "$ref": "#/tables/4" + }, + { + "$ref": "#/groups/127" + }, + { + "$ref": "#/groups/128" + }, + { + "$ref": "#/groups/129" + } + ], "content_layer": "body", - "label": "text", + "label": "section_header", "prov": [], - "orig": "4", - "text": "4", - "formatting": { - "bold": false, - "italic": false, - "underline": false, - "strikethrough": false, - "script": "sub" - } + "orig": "Farm management", + "text": "Farm management", + "level": 2 }, { - "self_ref": "#/texts/173", + "self_ref": "#/texts/386", "parent": { - "$ref": "#/groups/11" + "$ref": "#/texts/385" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "emission from manure was estimated according to IPCC [38], which considered daily volatile solid (VS) excreted (kg DM cow", - "text": "emission from manure was estimated according to IPCC [38], which considered daily volatile solid (VS) excreted (kg DM cow" + "orig": "Emissions due to farm management included those from fuel and machinery for manure handling and electricity for milking and confinement (Table 5). Emissions due to feed processing such as cutting, crushing, mixing and distributing, as well as secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were included in ‘Emissions from crop and pasture production’ section.", + "text": "Emissions due to farm management included those from fuel and machinery for manure handling and electricity for milking and confinement (Table 5). Emissions due to feed processing such as cutting, crushing, mixing and distributing, as well as secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were included in ‘Emissions from crop and pasture production’ section." }, { - "self_ref": "#/texts/174", + "self_ref": "#/texts/387", "parent": { - "$ref": "#/groups/11" + "$ref": "#/body" }, "children": [], "content_layer": "body", - "label": "text", + "label": "caption", "prov": [], - "orig": "-1", - "text": "-1", - "formatting": { - "bold": false, - "italic": false, - "underline": false, - "strikethrough": false, - "script": "super" - } + "orig": "Table 5 Factors for major resource inputs in farm management.", + "text": "Table 5 Factors for major resource inputs in farm management." }, { - "self_ref": "#/texts/175", + "self_ref": "#/texts/388", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/102" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ") in manure. The daily VS was estimated as proposed by Eugène et al. [44] as: VS = NDOMI + (UE × GE) × (OM/18.45), where: VS = volatile solid excretion on an organic matter (OM) basis (kg day", - "text": ") in manure. The daily VS was estimated as proposed by Eugène et al. [44] as: VS = NDOMI + (UE × GE) × (OM/18.45), where: VS = volatile solid excretion on an organic matter (OM) basis (kg day" + "orig": "Unit", + "text": "Unit" }, { - "self_ref": "#/texts/176", + "self_ref": "#/texts/389", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/102" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "a", + "text": "a", "formatting": { "bold": false, "italic": false, @@ -4656,52 +10021,52 @@ } }, { - "self_ref": "#/texts/177", + "self_ref": "#/texts/390", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/104" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "), NDOMI = non-digestible OM intake (kg day", - "text": "), NDOMI = non-digestible OM intake (kg day" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/178", + "self_ref": "#/texts/391", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/104" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/179", + "self_ref": "#/texts/392", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/104" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "): (1- OM digestibility) × OM intake, UE = urinary energy excretion as a fraction of GE (0.04), GE = gross energy intake (MJ day", - "text": "): (1- OM digestibility) × OM intake, UE = urinary energy excretion as a fraction of GE (0.04), GE = gross energy intake (MJ day" + "orig": "e L", + "text": "e L" }, { - "self_ref": "#/texts/180", + "self_ref": "#/texts/393", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/104" }, "children": [], "content_layer": "body", @@ -4718,107 +10083,114 @@ } }, { - "self_ref": "#/texts/181", + "self_ref": "#/texts/394", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/106" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "), OM = organic matter (g), 18.45 = conversion factor for dietary GE per kg of DM (MJ kg", - "text": "), OM = organic matter (g), 18.45 = conversion factor for dietary GE per kg of DM (MJ kg" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/182", + "self_ref": "#/texts/395", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/106" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "-1", - "text": "-1", + "orig": "2", + "text": "2", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "super" + "script": "sub" } }, { - "self_ref": "#/texts/183", + "self_ref": "#/texts/396", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/106" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": ").", - "text": ")." + "orig": "e L", + "text": "e L" }, { - "self_ref": "#/texts/184", + "self_ref": "#/texts/397", "parent": { - "$ref": "#/texts/160" + "$ref": "#/groups/106" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The OM digestibility was estimated as a function of chemical composition, using equations published by INRA [21], which takes into account the effects of digestive interactions due to feeding level, the proportion of concentrate and rumen protein balance on OM digestibility. For scenarios where cows had access to grazing, the amount of calculated VS were corrected as a function of the time at pasture. The biodegradability of manure factor (0.13 for dairy cows in Latin America) and methane conversion factor (MCF) values were taken from IPCC [38]. The MCF values for pit storage below animal confinements (> 1 month) were used for the calculation, taking into account the annual average temperature (16.6ºC) or the average temperatures during the growth period of temperate (14.4ºC) or tropical (21ºC) annual pastures, which were 31%, 26% and 46%, respectively.", - "text": "The OM digestibility was estimated as a function of chemical composition, using equations published by INRA [21], which takes into account the effects of digestive interactions due to feeding level, the proportion of concentrate and rumen protein balance on OM digestibility. For scenarios where cows had access to grazing, the amount of calculated VS were corrected as a function of the time at pasture. The biodegradability of manure factor (0.13 for dairy cows in Latin America) and methane conversion factor (MCF) values were taken from IPCC [38]. The MCF values for pit storage below animal confinements (> 1 month) were used for the calculation, taking into account the annual average temperature (16.6ºC) or the average temperatures during the growth period of temperate (14.4ºC) or tropical (21ºC) annual pastures, which were 31%, 26% and 46%, respectively." + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/185", + "self_ref": "#/texts/398", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/108" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "The N", - "text": "The N" + "orig": "Production of electricity", + "text": "Production of electricity" }, { - "self_ref": "#/texts/186", + "self_ref": "#/texts/399", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/108" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "b", + "text": "b", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/187", + "self_ref": "#/texts/400", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/110" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N emissions from urine and feces were estimated considering the proportion of N excreted as manure and storage or as urine and dung deposited by grazing animals. These proportions were calculated based on the proportion of daily time that animals stayed on pasture (7 h/24 h = 0.29) or confinement (1−0.29 = 0.71). For lactating heifers and cows, the total amount of N excreted was calculated by the difference between N intake and milk N excretion. For heifers and non-lactating cows, urinary and fecal N excretion were estimated as proposed by Reed et al. [45] (Table 3: equations 10 and 12, respectively). The N", - "text": "O-N emissions from urine and feces were estimated considering the proportion of N excreted as manure and storage or as urine and dung deposited by grazing animals. These proportions were calculated based on the proportion of daily time that animals stayed on pasture (7 h/24 h = 0.29) or confinement (1−0.29 = 0.71). For lactating heifers and cows, the total amount of N excreted was calculated by the difference between N intake and milk N excretion. For heifers and non-lactating cows, urinary and fecal N excretion were estimated as proposed by Reed et al. [45] (Table 3: equations 10 and 12, respectively). The N" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/188", + "self_ref": "#/texts/401", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/110" }, "children": [], "content_layer": "body", @@ -4835,83 +10207,83 @@ } }, { - "self_ref": "#/texts/189", + "self_ref": "#/texts/402", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/110" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O emissions from stored manure as well as urine and dung during grazing were calculated based on the conversion of N", - "text": "O emissions from stored manure as well as urine and dung during grazing were calculated based on the conversion of N" + "orig": "e kWh", + "text": "e kWh" }, { - "self_ref": "#/texts/190", + "self_ref": "#/texts/403", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/110" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/191", + "self_ref": "#/texts/404", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/112" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N emissions to N", - "text": "O-N emissions to N" + "orig": "Production of electricity (alternative)", + "text": "Production of electricity (alternative)" }, { - "self_ref": "#/texts/192", + "self_ref": "#/texts/405", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/112" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "c", + "text": "c", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/193", + "self_ref": "#/texts/406", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/114" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O emissions, where N", - "text": "O emissions, where N" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/194", + "self_ref": "#/texts/407", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/114" }, "children": [], "content_layer": "body", @@ -4928,52 +10300,52 @@ } }, { - "self_ref": "#/texts/195", + "self_ref": "#/texts/408", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/114" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O emissions = N", - "text": "O emissions = N" + "orig": "e kWh", + "text": "e kWh" }, { - "self_ref": "#/texts/196", + "self_ref": "#/texts/409", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/114" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/197", + "self_ref": "#/texts/410", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/116" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N emissions × 44/28. The emission factors were 0.002 kg N", - "text": "O-N emissions × 44/28. The emission factors were 0.002 kg N" + "orig": "kg CO", + "text": "kg CO" }, { - "self_ref": "#/texts/198", + "self_ref": "#/texts/411", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/116" }, "children": [], "content_layer": "body", @@ -4990,21 +10362,21 @@ } }, { - "self_ref": "#/texts/199", + "self_ref": "#/texts/412", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/116" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N (kg N)", - "text": "O-N (kg N)" + "orig": "e (kg mm)", + "text": "e (kg mm)" }, { - "self_ref": "#/texts/200", + "self_ref": "#/texts/413", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/116" }, "children": [], "content_layer": "body", @@ -5021,52 +10393,52 @@ } }, { - "self_ref": "#/texts/201", + "self_ref": "#/texts/414", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/118" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "stored in a pit below animal confinements, and 0.02 kg N", - "text": "stored in a pit below animal confinements, and 0.02 kg N" + "orig": "L diesel tonne", + "text": "L diesel tonne" }, { - "self_ref": "#/texts/202", + "self_ref": "#/texts/415", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/118" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/203", + "self_ref": "#/texts/416", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/120" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O-N (kg of urine and dung)", - "text": "O-N (kg of urine and dung)" + "orig": "kg mm kg", + "text": "kg mm kg" }, { - "self_ref": "#/texts/204", + "self_ref": "#/texts/417", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/120" }, "children": [], "content_layer": "body", @@ -5083,105 +10455,102 @@ } }, { - "self_ref": "#/texts/205", + "self_ref": "#/texts/418", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/122" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "deposited on pasture [38]. The indirect N", - "text": "deposited on pasture [38]. The indirect N" + "orig": "kWh (kg milk)", + "text": "kWh (kg milk)" }, { - "self_ref": "#/texts/206", + "self_ref": "#/texts/419", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/122" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "2", - "text": "2", + "orig": "-1", + "text": "-1", "formatting": { "bold": false, "italic": false, "underline": false, "strikethrough": false, - "script": "sub" + "script": "super" } }, { - "self_ref": "#/texts/207", + "self_ref": "#/texts/420", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/124" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "O emissions from storage manure and urine and dung deposits on pasture were also estimated using the IPCC [38] emission factors.", - "text": "O emissions from storage manure and urine and dung deposits on pasture were also estimated using the IPCC [38] emission factors." + "orig": "Electricity for lighting", + "text": "Electricity for lighting" }, { - "self_ref": "#/texts/208", + "self_ref": "#/texts/421", "parent": { - "$ref": "#/texts/43" + "$ref": "#/groups/124" }, - "children": [ - { - "$ref": "#/texts/209" - }, - { - "$ref": "#/tables/4" - }, - { - "$ref": "#/groups/13" - }, - { - "$ref": "#/groups/14" - }, - { - "$ref": "#/groups/15" - } - ], + "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Farm management", - "text": "Farm management", - "level": 2 + "orig": "d", + "text": "d", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/209", + "self_ref": "#/texts/422", "parent": { - "$ref": "#/texts/208" + "$ref": "#/groups/126" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Emissions due to farm management included those from fuel and machinery for manure handling and electricity for milking and confinement (Table 5). Emissions due to feed processing such as cutting, crushing, mixing and distributing, as well as secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were included in ‘Emissions from crop and pasture production’ section.", - "text": "Emissions due to farm management included those from fuel and machinery for manure handling and electricity for milking and confinement (Table 5). Emissions due to feed processing such as cutting, crushing, mixing and distributing, as well as secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were included in ‘Emissions from crop and pasture production’ section." + "orig": "kWh cow", + "text": "kWh cow" }, { - "self_ref": "#/texts/210", + "self_ref": "#/texts/423", "parent": { - "$ref": "#/body" + "$ref": "#/groups/126" }, "children": [], "content_layer": "body", - "label": "caption", + "label": "text", "prov": [], - "orig": "Table 5 Factors for major resource inputs in farm management.", - "text": "Table 5 Factors for major resource inputs in farm management." + "orig": "-1", + "text": "-1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } }, { - "self_ref": "#/texts/211", + "self_ref": "#/texts/424", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/127" }, "children": [], "content_layer": "body", @@ -5191,9 +10560,9 @@ "text": "The amount of fuel use for manure handling were estimated taking into consideration the amount of manure produced per cow and the amounts of fuel required for manure handling (L diesel t" }, { - "self_ref": "#/texts/212", + "self_ref": "#/texts/425", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/127" }, "children": [], "content_layer": "body", @@ -5210,9 +10579,9 @@ } }, { - "self_ref": "#/texts/213", + "self_ref": "#/texts/426", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/127" }, "children": [], "content_layer": "body", @@ -5222,9 +10591,9 @@ "text": ") [42]. The amount of manure was estimated from OM excretions (kg cow" }, { - "self_ref": "#/texts/214", + "self_ref": "#/texts/427", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/127" }, "children": [], "content_layer": "body", @@ -5241,9 +10610,9 @@ } }, { - "self_ref": "#/texts/215", + "self_ref": "#/texts/428", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/127" }, "children": [], "content_layer": "body", @@ -5253,9 +10622,9 @@ "text": "), assuming that the manure has 8% ash on DM basis and 60% DM content. The OM excretions were calculated by NDOMI × days in confinement × proportion of daily time that animals stayed on confinement." }, { - "self_ref": "#/texts/216", + "self_ref": "#/texts/429", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5265,9 +10634,9 @@ "text": "The emissions from fuel were estimated considering the primary (emissions from fuel burned) and secondary (emissions for producing and transporting fuel) emissions. The primary emissions were calculated by the amount of fuel required for manure handling (L) × (kg CO" }, { - "self_ref": "#/texts/217", + "self_ref": "#/texts/430", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5284,9 +10653,9 @@ } }, { - "self_ref": "#/texts/218", + "self_ref": "#/texts/431", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5296,9 +10665,9 @@ "text": "e L" }, { - "self_ref": "#/texts/219", + "self_ref": "#/texts/432", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5315,9 +10684,9 @@ } }, { - "self_ref": "#/texts/220", + "self_ref": "#/texts/433", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5327,9 +10696,9 @@ "text": ") [41]. The secondary emissions from fuel were calculated by the amount of fuel required for manure handling × emissions for production and transport of fuel (kg CO" }, { - "self_ref": "#/texts/221", + "self_ref": "#/texts/434", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5346,9 +10715,9 @@ } }, { - "self_ref": "#/texts/222", + "self_ref": "#/texts/435", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5358,9 +10727,9 @@ "text": "e L" }, { - "self_ref": "#/texts/223", + "self_ref": "#/texts/436", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5377,9 +10746,9 @@ } }, { - "self_ref": "#/texts/224", + "self_ref": "#/texts/437", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5389,9 +10758,9 @@ "text": ") [41]. Emissions from manufacture and repair of machinery for manure handling were estimated by manure produced per cow (t) × (kg machinery mass (kg manure)" }, { - "self_ref": "#/texts/225", + "self_ref": "#/texts/438", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5408,9 +10777,9 @@ } }, { - "self_ref": "#/texts/226", + "self_ref": "#/texts/439", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5420,9 +10789,9 @@ "text": "× 10" }, { - "self_ref": "#/texts/227", + "self_ref": "#/texts/440", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5439,9 +10808,9 @@ } }, { - "self_ref": "#/texts/228", + "self_ref": "#/texts/441", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5451,9 +10820,9 @@ "text": ") [42] × kg CO" }, { - "self_ref": "#/texts/229", + "self_ref": "#/texts/442", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5470,9 +10839,9 @@ } }, { - "self_ref": "#/texts/230", + "self_ref": "#/texts/443", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5482,9 +10851,9 @@ "text": "e (kg machinery mass)" }, { - "self_ref": "#/texts/231", + "self_ref": "#/texts/444", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5501,9 +10870,9 @@ } }, { - "self_ref": "#/texts/232", + "self_ref": "#/texts/445", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/128" }, "children": [], "content_layer": "body", @@ -5513,9 +10882,9 @@ "text": "[42]." }, { - "self_ref": "#/texts/233", + "self_ref": "#/texts/446", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5525,9 +10894,9 @@ "text": "Emissions from electricity for milking and confinement were estimated using two emission factors (kg CO" }, { - "self_ref": "#/texts/234", + "self_ref": "#/texts/447", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5544,9 +10913,9 @@ } }, { - "self_ref": "#/texts/235", + "self_ref": "#/texts/448", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5556,9 +10925,9 @@ "text": "kWh" }, { - "self_ref": "#/texts/236", + "self_ref": "#/texts/449", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5575,9 +10944,9 @@ } }, { - "self_ref": "#/texts/237", + "self_ref": "#/texts/450", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5587,9 +10956,9 @@ "text": "). The first one is based on United States electricity matrix [41], and was used as a reference of an electricity matrix with less hydroelectric power than the region under study. The second is based on the Brazilian electricity matrix [46]. The electricity required for milking activities is 0.06 kWh (kg milk produced)" }, { - "self_ref": "#/texts/238", + "self_ref": "#/texts/451", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5606,9 +10975,9 @@ } }, { - "self_ref": "#/texts/239", + "self_ref": "#/texts/452", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5618,9 +10987,9 @@ "text": "[47]. The annual electricity use for lighting was 75 kWh cow" }, { - "self_ref": "#/texts/240", + "self_ref": "#/texts/453", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5637,9 +11006,9 @@ } }, { - "self_ref": "#/texts/241", + "self_ref": "#/texts/454", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/129" }, "children": [], "content_layer": "body", @@ -5649,13 +11018,13 @@ "text": ", which is the value considered for lactating cows in naturally ventilated barns [47]." }, { - "self_ref": "#/texts/242", + "self_ref": "#/texts/455", "parent": { "$ref": "#/texts/43" }, "children": [ { - "$ref": "#/groups/16" + "$ref": "#/groups/130" } ], "content_layer": "body", @@ -5666,9 +11035,9 @@ "level": 2 }, { - "self_ref": "#/texts/243", + "self_ref": "#/texts/456", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5678,9 +11047,9 @@ "text": "The C footprint for milk produced in the system was calculated using a biophysical allocation approach, as recommended by the International Dairy Federation [49], and described by Thoma et al. [48]. Briefly, AR" }, { - "self_ref": "#/texts/244", + "self_ref": "#/texts/457", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5697,9 +11066,9 @@ } }, { - "self_ref": "#/texts/245", + "self_ref": "#/texts/458", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5709,9 +11078,9 @@ "text": "= 1–6.04 × BMR, where" }, { - "self_ref": "#/texts/246", + "self_ref": "#/texts/459", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5728,9 +11097,9 @@ } }, { - "self_ref": "#/texts/247", + "self_ref": "#/texts/460", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5740,9 +11109,9 @@ "text": "AR" }, { - "self_ref": "#/texts/248", + "self_ref": "#/texts/461", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5759,9 +11128,9 @@ } }, { - "self_ref": "#/texts/249", + "self_ref": "#/texts/462", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5771,9 +11140,9 @@ "text": "is the allocation ratio for milk and BMR is cow BW at the time of slaughter (kg) + calf BW sold (kg) divided by the total ECM produced during cow`s entire life (kg). The AR" }, { - "self_ref": "#/texts/250", + "self_ref": "#/texts/463", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5790,9 +11159,9 @@ } }, { - "self_ref": "#/texts/251", + "self_ref": "#/texts/464", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5802,9 +11171,9 @@ "text": "were 0.854 and 0.849 for TMR and TMR with both pasture scenarios, respectively. The AR" }, { - "self_ref": "#/texts/252", + "self_ref": "#/texts/465", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5821,9 +11190,9 @@ } }, { - "self_ref": "#/texts/253", + "self_ref": "#/texts/466", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/130" }, "children": [], "content_layer": "body", @@ -5833,13 +11202,13 @@ "text": "was applied to the whole emissions, except for the electricity consumed for milking (milking parlor) and refrigerant loss, which was directly assigned to milk production." }, { - "self_ref": "#/texts/254", + "self_ref": "#/texts/467", "parent": { "$ref": "#/texts/43" }, "children": [ { - "$ref": "#/texts/255" + "$ref": "#/texts/468" } ], "content_layer": "body", @@ -5850,9 +11219,9 @@ "level": 2 }, { - "self_ref": "#/texts/255", + "self_ref": "#/texts/468", "parent": { - "$ref": "#/texts/254" + "$ref": "#/texts/467" }, "children": [], "content_layer": "body", @@ -5862,31 +11231,31 @@ "text": "A sensitivity index was calculated as described by Rotz et al. [42]. The sensitivity index was defined for each emission source as the percentage change in the C footprint for a 10% change in the given emission source divided by 10%. Thus, a value near 0 indicates a low sensitivity, whereas an index near or greater than 1 indicates a high sensitivity because a change in this value causes a similar change in the footprint." }, { - "self_ref": "#/texts/256", + "self_ref": "#/texts/469", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/257" + "$ref": "#/texts/470" }, { - "$ref": "#/texts/258" + "$ref": "#/texts/471" }, { - "$ref": "#/texts/328" + "$ref": "#/texts/541" }, { - "$ref": "#/texts/356" + "$ref": "#/texts/569" }, { - "$ref": "#/texts/403" + "$ref": "#/texts/616" }, { - "$ref": "#/texts/422" + "$ref": "#/texts/635" }, { - "$ref": "#/texts/428" + "$ref": "#/texts/641" } ], "content_layer": "body", @@ -5897,9 +11266,9 @@ "level": 1 }, { - "self_ref": "#/texts/257", + "self_ref": "#/texts/470", "parent": { - "$ref": "#/texts/256" + "$ref": "#/texts/469" }, "children": [], "content_layer": "body", @@ -5909,25 +11278,25 @@ "text": "The study has assessed the impact of tropical and temperate pastures in dairy cows fed TMR on the C footprint of dairy production in subtropics. Different factors were taken in to consideration to estimate emissions from manure (or urine and dung) of grazing animals, feed production and electricity use." }, { - "self_ref": "#/texts/258", + "self_ref": "#/texts/471", "parent": { - "$ref": "#/texts/256" + "$ref": "#/texts/469" }, "children": [ { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, { "$ref": "#/pictures/1" }, { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, { - "$ref": "#/groups/20" + "$ref": "#/groups/134" } ], "content_layer": "body", @@ -5938,9 +11307,9 @@ "level": 2 }, { - "self_ref": "#/texts/259", + "self_ref": "#/texts/472", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -5950,9 +11319,9 @@ "text": "Depending on emission factors used for calculating emissions from urine and dung (IPCC or local data) and feed production (Tables 3 or 4), the C footprint was similar (Fig 2A and 2B) or decreased by 0.04 kg CO" }, { - "self_ref": "#/texts/260", + "self_ref": "#/texts/473", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -5969,9 +11338,9 @@ } }, { - "self_ref": "#/texts/261", + "self_ref": "#/texts/474", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -5981,9 +11350,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/262", + "self_ref": "#/texts/475", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6000,9 +11369,9 @@ } }, { - "self_ref": "#/texts/263", + "self_ref": "#/texts/476", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6012,9 +11381,9 @@ "text": "(Fig 2C and 2D) in scenarios that included pastures compared to" }, { - "self_ref": "#/texts/264", + "self_ref": "#/texts/477", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6031,9 +11400,9 @@ } }, { - "self_ref": "#/texts/265", + "self_ref": "#/texts/478", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6043,9 +11412,9 @@ "text": "TMR intake. Due to differences in emission factors, the overall GHG emission values ranged from 0.92 to 1.04 kg CO" }, { - "self_ref": "#/texts/266", + "self_ref": "#/texts/479", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6062,9 +11431,9 @@ } }, { - "self_ref": "#/texts/267", + "self_ref": "#/texts/480", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6074,9 +11443,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/268", + "self_ref": "#/texts/481", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6093,9 +11462,9 @@ } }, { - "self_ref": "#/texts/269", + "self_ref": "#/texts/482", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6105,9 +11474,9 @@ "text": "for dairy cows receiving TMR exclusively, and from 0.88 to 1.04 kg CO" }, { - "self_ref": "#/texts/270", + "self_ref": "#/texts/483", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6124,9 +11493,9 @@ } }, { - "self_ref": "#/texts/271", + "self_ref": "#/texts/484", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6136,9 +11505,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/272", + "self_ref": "#/texts/485", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6155,9 +11524,9 @@ } }, { - "self_ref": "#/texts/273", + "self_ref": "#/texts/486", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6167,9 +11536,9 @@ "text": "for cows with access to pasture. Using IPCC emission factors [38], manure emissions increased as TMR intake went down (Fig 2A and 2B). However, using local emission factors for estimating N" }, { - "self_ref": "#/texts/274", + "self_ref": "#/texts/487", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6186,9 +11555,9 @@ } }, { - "self_ref": "#/texts/275", + "self_ref": "#/texts/488", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/131" }, "children": [], "content_layer": "body", @@ -6198,7 +11567,7 @@ "text": "O-N emissions [37], manure emissions decreased as TMR intake went down (Fig 2C and 2D). Regardless of emission factors used (Tables 3 or 4), emissions from feed production decreased to a small extent as the proportion of TMR intake decreased. Emissions from farm management did not contribute more than 5% of overall GHG emissions." }, { - "self_ref": "#/texts/276", + "self_ref": "#/texts/489", "parent": { "$ref": "#/body" }, @@ -6210,9 +11579,9 @@ "text": "Fig 2 Overall greenhouse gas emissions in dairy cattle systems under various scenarios. TMR = ad libitum TMR intake, 75TMR = 75% of ad libitum TMR intake with access to pasture, 50TMR = 50% of ad libitum TMR intake with access to pasture. (a) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.73 kg CO2e kWh-1 [41]. (b) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]; (c) N2O emission factors for urine and dung from local data [37], feed production EF from Table 4 without accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. (d) N2O emission factors for urine and dung from local data [37], feed production emission factors from Table 4 accounting for sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]." }, { - "self_ref": "#/texts/277", + "self_ref": "#/texts/490", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6222,9 +11591,9 @@ "text": "Considering IPCC emission factors for N" }, { - "self_ref": "#/texts/278", + "self_ref": "#/texts/491", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6241,9 +11610,9 @@ } }, { - "self_ref": "#/texts/279", + "self_ref": "#/texts/492", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6253,9 +11622,9 @@ "text": "O emissions from urine and dung [38] and those from Table 3, the C footprint ranged from 0.99 to 1.04 kg CO" }, { - "self_ref": "#/texts/280", + "self_ref": "#/texts/493", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6272,9 +11641,9 @@ } }, { - "self_ref": "#/texts/281", + "self_ref": "#/texts/494", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6284,9 +11653,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/282", + "self_ref": "#/texts/495", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6303,9 +11672,9 @@ } }, { - "self_ref": "#/texts/283", + "self_ref": "#/texts/496", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6315,9 +11684,9 @@ "text": ", and was close to those reported under confined based systems in California [49], Canada [50], China [8], Ireland [9], different scenarios in Australia [51,52] and Uruguay [11], which ranged from 0.98 to 1.16 kg CO" }, { - "self_ref": "#/texts/284", + "self_ref": "#/texts/497", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6334,9 +11703,9 @@ } }, { - "self_ref": "#/texts/285", + "self_ref": "#/texts/498", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6346,9 +11715,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/286", + "self_ref": "#/texts/499", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6365,9 +11734,9 @@ } }, { - "self_ref": "#/texts/287", + "self_ref": "#/texts/500", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6377,9 +11746,9 @@ "text": ". When local emission factors for N" }, { - "self_ref": "#/texts/288", + "self_ref": "#/texts/501", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6396,9 +11765,9 @@ } }, { - "self_ref": "#/texts/289", + "self_ref": "#/texts/502", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6408,9 +11777,9 @@ "text": "O emissions from urine and dung [37] and those from Table 4 were taking into account, the C footprint for scenarios including pasture, without accounting for sequestered CO" }, { - "self_ref": "#/texts/290", + "self_ref": "#/texts/503", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6427,9 +11796,9 @@ } }, { - "self_ref": "#/texts/291", + "self_ref": "#/texts/504", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6439,9 +11808,9 @@ "text": "-C from perennial pasture—0.91 kg CO" }, { - "self_ref": "#/texts/292", + "self_ref": "#/texts/505", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6458,9 +11827,9 @@ } }, { - "self_ref": "#/texts/293", + "self_ref": "#/texts/506", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6470,9 +11839,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/294", + "self_ref": "#/texts/507", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6489,9 +11858,9 @@ } }, { - "self_ref": "#/texts/295", + "self_ref": "#/texts/508", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6501,9 +11870,9 @@ "text": "—was lower than the range of values described above. However, these values were still greater than high-performance confinement systems in UK and USA [53] or grass based dairy systems in Ireland [9,53] and New Zealand [8,54], which ranged from 0.52 to 0.89 kg CO" }, { - "self_ref": "#/texts/296", + "self_ref": "#/texts/509", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6520,9 +11889,9 @@ } }, { - "self_ref": "#/texts/297", + "self_ref": "#/texts/510", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6532,9 +11901,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/298", + "self_ref": "#/texts/511", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6551,9 +11920,9 @@ } }, { - "self_ref": "#/texts/299", + "self_ref": "#/texts/512", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6563,9 +11932,9 @@ "text": ". Regardless of which emission factor was used, we found a lower C footprint in all conditions compared to scenarios with lower milk production per cow or in poor conditions of manure management, which ranged from 1.4 to 2.3 kg CO" }, { - "self_ref": "#/texts/300", + "self_ref": "#/texts/513", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6582,9 +11951,9 @@ } }, { - "self_ref": "#/texts/301", + "self_ref": "#/texts/514", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6594,9 +11963,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/302", + "self_ref": "#/texts/515", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6613,9 +11982,9 @@ } }, { - "self_ref": "#/texts/303", + "self_ref": "#/texts/516", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6625,9 +11994,9 @@ "text": "[8,55]. Thus, even though differences between studies may be partially explained by various assumptions (e.g., emission factors, co-product allocation, methane emissions estimation, sequestered CO" }, { - "self_ref": "#/texts/304", + "self_ref": "#/texts/517", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6644,9 +12013,9 @@ } }, { - "self_ref": "#/texts/305", + "self_ref": "#/texts/518", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/132" }, "children": [], "content_layer": "body", @@ -6656,9 +12025,9 @@ "text": "-C, etc.), herd productivity and manure management were systematically associated with the C footprint of the dairy systems." }, { - "self_ref": "#/texts/306", + "self_ref": "#/texts/519", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6668,9 +12037,9 @@ "text": "The similarity of C footprint between different scenarios using IPCC [38] for estimating emissions from manure and for emissions from feed production (Table 3) was a consequence of the trade-off between greater manure emissions and lower emissions to produce feed, as the proportion of pasture in diets increased. Additionally, the small negative effect of pasture on ECM production also contributed to the trade-off. The impact of milk production on the C footprint was reported in a meta-analysis comprising 30 studies from 15 different countries [22]. As observed in this study (Fig 2A and 2B) the authors reported no significant difference between the C footprint of pasture-based vs. confinement systems. However, they observed that an increase of 1000 kg cow" }, { - "self_ref": "#/texts/307", + "self_ref": "#/texts/520", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6687,9 +12056,9 @@ } }, { - "self_ref": "#/texts/308", + "self_ref": "#/texts/521", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6699,9 +12068,9 @@ "text": "(5000 to 6000 kg ECM) reduced the C footprint by 0.12 kg CO" }, { - "self_ref": "#/texts/309", + "self_ref": "#/texts/522", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6718,9 +12087,9 @@ } }, { - "self_ref": "#/texts/310", + "self_ref": "#/texts/523", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6730,9 +12099,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/311", + "self_ref": "#/texts/524", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6749,9 +12118,9 @@ } }, { - "self_ref": "#/texts/312", + "self_ref": "#/texts/525", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6761,9 +12130,9 @@ "text": ", which may explain an apparent discrepancy between our study and an LCA performed in south Brazilian conditions [56]. Their study compared a confinement and a grazing-based dairy system with annual average milk production of 7667 and 5535 kg cow, respectively. In this study, the same herd was used in all systems, with an annual average milk production of around 7000 kg cow" }, { - "self_ref": "#/texts/313", + "self_ref": "#/texts/526", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6780,9 +12149,9 @@ } }, { - "self_ref": "#/texts/314", + "self_ref": "#/texts/527", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/133" }, "children": [], "content_layer": "body", @@ -6792,9 +12161,9 @@ "text": ". Experimental data showed a reduction not greater than 3% of ECM when 50% of TMR was replaced by pasture access." }, { - "self_ref": "#/texts/315", + "self_ref": "#/texts/528", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6804,9 +12173,9 @@ "text": "The lower C footprint in scenarios with access to pasture, when local emission factors [37] were used for N" }, { - "self_ref": "#/texts/316", + "self_ref": "#/texts/529", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6823,9 +12192,9 @@ } }, { - "self_ref": "#/texts/317", + "self_ref": "#/texts/530", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6835,9 +12204,9 @@ "text": "O emissions from urine and dung and for feed production (Table 4), may also be partially attributed to the small negative effect of pasture on ECM production. Nevertheless, local emission factors for urine and dung had a great impact on scenarios including pastures compared to" }, { - "self_ref": "#/texts/318", + "self_ref": "#/texts/531", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6854,9 +12223,9 @@ } }, { - "self_ref": "#/texts/319", + "self_ref": "#/texts/532", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6866,9 +12235,9 @@ "text": "TMR intake. Whereas the IPCC [38] considers an emission of 0.02 kg N" }, { - "self_ref": "#/texts/320", + "self_ref": "#/texts/533", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6885,9 +12254,9 @@ } }, { - "self_ref": "#/texts/321", + "self_ref": "#/texts/534", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6897,9 +12266,9 @@ "text": "O-N (kg N)" }, { - "self_ref": "#/texts/322", + "self_ref": "#/texts/535", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6916,9 +12285,9 @@ } }, { - "self_ref": "#/texts/323", + "self_ref": "#/texts/536", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6928,9 +12297,9 @@ "text": "for urine and dung from grazing animals, experimental evidence shows that it may be up to five times lower, averaging 0.004 kg N" }, { - "self_ref": "#/texts/324", + "self_ref": "#/texts/537", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6947,9 +12316,9 @@ } }, { - "self_ref": "#/texts/325", + "self_ref": "#/texts/538", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6959,9 +12328,9 @@ "text": "O-N kg" }, { - "self_ref": "#/texts/326", + "self_ref": "#/texts/539", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6978,9 +12347,9 @@ } }, { - "self_ref": "#/texts/327", + "self_ref": "#/texts/540", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/134" }, "children": [], "content_layer": "body", @@ -6990,19 +12359,19 @@ "text": "[37]." }, { - "self_ref": "#/texts/328", + "self_ref": "#/texts/541", "parent": { - "$ref": "#/texts/256" + "$ref": "#/texts/469" }, "children": [ { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, { "$ref": "#/pictures/2" }, { - "$ref": "#/groups/22" + "$ref": "#/groups/136" } ], "content_layer": "body", @@ -7013,9 +12382,9 @@ "level": 2 }, { - "self_ref": "#/texts/329", + "self_ref": "#/texts/542", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7025,9 +12394,9 @@ "text": "The enteric CH" }, { - "self_ref": "#/texts/330", + "self_ref": "#/texts/543", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7044,9 +12413,9 @@ } }, { - "self_ref": "#/texts/331", + "self_ref": "#/texts/544", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7056,9 +12425,9 @@ "text": "intensity was similar between different scenarios (Fig 2), showing the greatest sensitivity index, with values ranging from 0.53 to 0.62, which indicate that for a 10% change in this source, the C footprint may change between 5.3 and 6.2% (Fig 3). The large effect of enteric CH" }, { - "self_ref": "#/texts/332", + "self_ref": "#/texts/545", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7075,9 +12444,9 @@ } }, { - "self_ref": "#/texts/333", + "self_ref": "#/texts/546", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7087,9 +12456,9 @@ "text": "emissions on the whole C footprint was expected, because the impact of enteric CH" }, { - "self_ref": "#/texts/334", + "self_ref": "#/texts/547", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7106,9 +12475,9 @@ } }, { - "self_ref": "#/texts/335", + "self_ref": "#/texts/548", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7118,9 +12487,9 @@ "text": "on GHG emissions of milk production in different dairy systems has been estimated to range from 44 to 60% of the total CO" }, { - "self_ref": "#/texts/336", + "self_ref": "#/texts/549", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7137,9 +12506,9 @@ } }, { - "self_ref": "#/texts/337", + "self_ref": "#/texts/550", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7149,9 +12518,9 @@ "text": "e [50,52,57,58]. However, emissions in feed production may be the most important source of GHG when emission factors for producing concentrate feeds are greater than 0.7 kg CO" }, { - "self_ref": "#/texts/338", + "self_ref": "#/texts/551", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7168,9 +12537,9 @@ } }, { - "self_ref": "#/texts/339", + "self_ref": "#/texts/552", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7180,9 +12549,9 @@ "text": "e kg" }, { - "self_ref": "#/texts/340", + "self_ref": "#/texts/553", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7199,9 +12568,9 @@ } }, { - "self_ref": "#/texts/341", + "self_ref": "#/texts/554", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/135" }, "children": [], "content_layer": "body", @@ -7211,7 +12580,7 @@ "text": "[59], which did not happen in this study." }, { - "self_ref": "#/texts/342", + "self_ref": "#/texts/555", "parent": { "$ref": "#/body" }, @@ -7223,9 +12592,9 @@ "text": "Fig 3 Sensitivity of the C footprint. Sensitivity index = percentage change in C footprint for a 10% change in the given emission source divided by 10% of. (a) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3, production of electricity = 0.73 kg CO2e kWh-1 [41]. (b) N2O emission factors for urine and dung from IPCC [38], feed production emission factors from Table 3, production of electricity = 0.205 kg CO2e kWh-1 [46]; (c) N2O emission factors for urine and dung from local data [37], feed production EF from Table 4 without accounting sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]. (d) N2O emission factors for urine and dung from local data [37], feed production emission factors from Table 4 accounting sequestered CO2-C from perennial pasture, production of electricity = 0.205 kg CO2e kWh-1 [46]." }, { - "self_ref": "#/texts/343", + "self_ref": "#/texts/556", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7235,9 +12604,9 @@ "text": "The lack of difference in enteric CH" }, { - "self_ref": "#/texts/344", + "self_ref": "#/texts/557", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7254,9 +12623,9 @@ } }, { - "self_ref": "#/texts/345", + "self_ref": "#/texts/558", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7266,9 +12635,9 @@ "text": "emissions in different systems can be explained by the narrow range of NDF content in diets (<4% difference). This non-difference is due to the lower NDF content of annual temperate pastures (495 g (kg DM)" }, { - "self_ref": "#/texts/346", + "self_ref": "#/texts/559", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7285,9 +12654,9 @@ } }, { - "self_ref": "#/texts/347", + "self_ref": "#/texts/560", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7297,9 +12666,9 @@ "text": ") compared to corn silage (550 g (kg DM)" }, { - "self_ref": "#/texts/348", + "self_ref": "#/texts/561", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7316,9 +12685,9 @@ } }, { - "self_ref": "#/texts/349", + "self_ref": "#/texts/562", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7328,9 +12697,9 @@ "text": "). Hence, an expected, increase NDF content with decreased concentrate was partially offset by an increase in the pasture proportion relatively low in NDF. This is in agreement with studies conducted in southern Brazil, which have shown that the actual enteric CH" }, { - "self_ref": "#/texts/350", + "self_ref": "#/texts/563", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7347,9 +12716,9 @@ } }, { - "self_ref": "#/texts/351", + "self_ref": "#/texts/564", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7359,9 +12728,9 @@ "text": "emissions may decrease with inclusion of temperate pastures in cows receiving corn silage and soybean meal [60] or increase enteric CH" }, { - "self_ref": "#/texts/352", + "self_ref": "#/texts/565", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7378,9 +12747,9 @@ } }, { - "self_ref": "#/texts/353", + "self_ref": "#/texts/566", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7390,9 +12759,9 @@ "text": "emissions when dairy cows grazing a temperate pasture was supplemented with corn silage [61]. Additionally, enteric CH" }, { - "self_ref": "#/texts/354", + "self_ref": "#/texts/567", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7409,9 +12778,9 @@ } }, { - "self_ref": "#/texts/355", + "self_ref": "#/texts/568", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/136" }, "children": [], "content_layer": "body", @@ -7421,22 +12790,22 @@ "text": "emissions did not differ between dairy cows receiving TMR exclusively or grazing a tropical pasture in the same scenarios as in this study [26]." }, { - "self_ref": "#/texts/356", + "self_ref": "#/texts/569", "parent": { - "$ref": "#/texts/256" + "$ref": "#/texts/469" }, "children": [ { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, { "$ref": "#/pictures/3" }, { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, { - "$ref": "#/texts/402" + "$ref": "#/texts/615" } ], "content_layer": "body", @@ -7447,9 +12816,9 @@ "level": 2 }, { - "self_ref": "#/texts/357", + "self_ref": "#/texts/570", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7459,9 +12828,9 @@ "text": "Using IPCC emission factors for N" }, { - "self_ref": "#/texts/358", + "self_ref": "#/texts/571", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7478,9 +12847,9 @@ } }, { - "self_ref": "#/texts/359", + "self_ref": "#/texts/572", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7490,9 +12859,9 @@ "text": "O emissions from urine and dung [38] and those from Table 3, CH" }, { - "self_ref": "#/texts/360", + "self_ref": "#/texts/573", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7509,9 +12878,9 @@ } }, { - "self_ref": "#/texts/361", + "self_ref": "#/texts/574", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7521,9 +12890,9 @@ "text": "emissions from manure decreased 0.07 kg CO" }, { - "self_ref": "#/texts/362", + "self_ref": "#/texts/575", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7540,9 +12909,9 @@ } }, { - "self_ref": "#/texts/363", + "self_ref": "#/texts/576", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7552,9 +12921,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/364", + "self_ref": "#/texts/577", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7571,9 +12940,9 @@ } }, { - "self_ref": "#/texts/365", + "self_ref": "#/texts/578", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7583,9 +12952,9 @@ "text": ", but N" }, { - "self_ref": "#/texts/366", + "self_ref": "#/texts/579", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7602,9 +12971,9 @@ } }, { - "self_ref": "#/texts/367", + "self_ref": "#/texts/580", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7614,9 +12983,9 @@ "text": "O emissions from manure increased 0.09 kg CO" }, { - "self_ref": "#/texts/368", + "self_ref": "#/texts/581", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7633,9 +13002,9 @@ } }, { - "self_ref": "#/texts/369", + "self_ref": "#/texts/582", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7645,9 +13014,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/370", + "self_ref": "#/texts/583", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7664,9 +13033,9 @@ } }, { - "self_ref": "#/texts/371", + "self_ref": "#/texts/584", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7676,9 +13045,9 @@ "text": ", as TMR intake was restricted to 50%" }, { - "self_ref": "#/texts/372", + "self_ref": "#/texts/585", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7695,9 +13064,9 @@ } }, { - "self_ref": "#/texts/373", + "self_ref": "#/texts/586", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7707,9 +13076,9 @@ "text": "(Fig 4A). Emissions for pastures increased by 0.06 kg CO" }, { - "self_ref": "#/texts/374", + "self_ref": "#/texts/587", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7726,9 +13095,9 @@ } }, { - "self_ref": "#/texts/375", + "self_ref": "#/texts/588", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7738,9 +13107,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/376", + "self_ref": "#/texts/589", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7757,9 +13126,9 @@ } }, { - "self_ref": "#/texts/377", + "self_ref": "#/texts/590", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7769,9 +13138,9 @@ "text": ", whereas emissions for producing concentrate feeds and corn silage decreased by 0.09 kg CO" }, { - "self_ref": "#/texts/378", + "self_ref": "#/texts/591", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7788,9 +13157,9 @@ } }, { - "self_ref": "#/texts/379", + "self_ref": "#/texts/592", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7800,9 +13169,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/380", + "self_ref": "#/texts/593", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7819,9 +13188,9 @@ } }, { - "self_ref": "#/texts/381", + "self_ref": "#/texts/594", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7831,9 +13200,9 @@ "text": ", as TMR intake decreased (Fig 4B). In this situation, the lack of difference in calculated C footprints of different systems was also due to the greater emissions from manure, and offset by lower emissions from feed production with inclusion of pasture in lactating dairy cow diets. The greater N" }, { - "self_ref": "#/texts/382", + "self_ref": "#/texts/595", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7850,9 +13219,9 @@ } }, { - "self_ref": "#/texts/383", + "self_ref": "#/texts/596", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7862,9 +13231,9 @@ "text": "O-N emissions from manure with pasture was a consequence of higher N" }, { - "self_ref": "#/texts/384", + "self_ref": "#/texts/597", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7881,9 +13250,9 @@ } }, { - "self_ref": "#/texts/385", + "self_ref": "#/texts/598", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7893,9 +13262,9 @@ "text": "O-N emissions due to greater CP content and N urine excretion, as pasture intake increased. The effect of CP content on urine N excretion has been shown by several authors in lactating dairy cows [62–64]. For instance, by decreasing CP content from 185 to 152 g (kg DM)" }, { - "self_ref": "#/texts/386", + "self_ref": "#/texts/599", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7912,9 +13281,9 @@ } }, { - "self_ref": "#/texts/387", + "self_ref": "#/texts/600", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7924,9 +13293,9 @@ "text": ", N intake decreased by 20% and urine N excretion by 60% [62]. In this study, the CP content for lactating dairy cows ranged from 150 g (kg DM)" }, { - "self_ref": "#/texts/388", + "self_ref": "#/texts/601", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7943,9 +13312,9 @@ } }, { - "self_ref": "#/texts/389", + "self_ref": "#/texts/602", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7955,9 +13324,9 @@ "text": "on TMR system to 198 g (kg DM)" }, { - "self_ref": "#/texts/390", + "self_ref": "#/texts/603", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7974,9 +13343,9 @@ } }, { - "self_ref": "#/texts/391", + "self_ref": "#/texts/604", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/137" }, "children": [], "content_layer": "body", @@ -7986,7 +13355,7 @@ "text": "on 50% TMR with pasture. Additionally, greater urine N excretion is expected with greater use of pasture. This occurs because protein utilization in pastures is inefficient, as the protein in fresh forages is highly degradable in the rumen and may not be captured by microbes [65]." }, { - "self_ref": "#/texts/392", + "self_ref": "#/texts/605", "parent": { "$ref": "#/body" }, @@ -7998,9 +13367,9 @@ "text": "Fig 4 Greenhouse gas emissions (GHG) from manure and feed production in dairy cattle systems. TMR = ad libitum TMR intake, 75TMR = 75% of ad libitum TMR intake with access to pasture, 50TMR = 50% of ad libitum TMR intake with access to pasture. (a) N2O emission factors for urine and dung from IPCC [38]. (b) Feed production emission factors from Table 3. (c) N2O emission factors for urine and dung from local data [37]. (d) Feed production emission factors from Table 4 accounting sequestered CO2-C from perennial pasture." }, { - "self_ref": "#/texts/393", + "self_ref": "#/texts/606", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8010,9 +13379,9 @@ "text": "Using local emission factors for N" }, { - "self_ref": "#/texts/394", + "self_ref": "#/texts/607", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8029,9 +13398,9 @@ } }, { - "self_ref": "#/texts/395", + "self_ref": "#/texts/608", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8041,9 +13410,9 @@ "text": "O emissions from urine and dung [37] and those from Table 4, reductions in CH" }, { - "self_ref": "#/texts/396", + "self_ref": "#/texts/609", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8060,9 +13429,9 @@ } }, { - "self_ref": "#/texts/397", + "self_ref": "#/texts/610", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8072,9 +13441,9 @@ "text": "emissions from stocked manure, when pastures were included on diets, did not offset by increases in N" }, { - "self_ref": "#/texts/398", + "self_ref": "#/texts/611", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8091,9 +13460,9 @@ } }, { - "self_ref": "#/texts/399", + "self_ref": "#/texts/612", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8103,9 +13472,9 @@ "text": "O emissions from excreta (Fig 4C). In this case, total emissions from manure (Fig 4C) and feed production (Fig 4D) decreased with the inclusion of pasture. The impact of greater CP content and N urine excretion with increased pasture intake was offset by the much lower emission factors used for N" }, { - "self_ref": "#/texts/400", + "self_ref": "#/texts/613", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8122,9 +13491,9 @@ } }, { - "self_ref": "#/texts/401", + "self_ref": "#/texts/614", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/138" }, "children": [], "content_layer": "body", @@ -8134,9 +13503,9 @@ "text": "O emissions from urine and dung. As suggested by other authors [66,67], these results show that IPCC default value may need to be revised for the subtropical region." }, { - "self_ref": "#/texts/402", + "self_ref": "#/texts/615", "parent": { - "$ref": "#/texts/356" + "$ref": "#/texts/569" }, "children": [], "content_layer": "body", @@ -8146,16 +13515,16 @@ "text": "Emissions for feed production decreased when pasture was included due to the greater emission factor for corn grain production compared to pastures. Emissions from concentrate and silage had at least twice the sensitivity index compared to emissions from pastures. The amount of grain required per cow in a lifetime decreased from 7,300 kg to 4,000 kg when 50% of TMR was replaced by pasture access. These results are in agreement with other studies which found lower C footprint, as concentrate use is reduced and/or pasture is included [9,68,69]. Moreover, it has been demonstrated that in intensive dairy systems, after enteric fermentation, feed production is the second main contributor to C footprint [50]. There is potential to decrease the environmental impact of dairy systems by reducing the use of concentrate ingredients with high environmental impact, particularly in confinements [9]." }, { - "self_ref": "#/texts/403", + "self_ref": "#/texts/616", "parent": { - "$ref": "#/texts/256" + "$ref": "#/texts/469" }, "children": [ { - "$ref": "#/texts/404" + "$ref": "#/texts/617" }, { - "$ref": "#/groups/25" + "$ref": "#/groups/139" } ], "content_layer": "body", @@ -8166,9 +13535,9 @@ "level": 2 }, { - "self_ref": "#/texts/404", + "self_ref": "#/texts/617", "parent": { - "$ref": "#/texts/403" + "$ref": "#/texts/616" }, "children": [], "content_layer": "body", @@ -8178,9 +13547,9 @@ "text": "The lower impact of emissions from farm management is in agreement with other studies conducted in Europe [9, 62] and USA [42, 55], where the authors found that most emissions in dairy production systems are from enteric fermentation, feed production and emissions from excreta. As emissions from fuel for on-farm feed production were accounted into the ‘emissions from crop and pasture production’, total emissions from farm management were not greater than 5% of total C footprint." }, { - "self_ref": "#/texts/405", + "self_ref": "#/texts/618", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8190,9 +13559,9 @@ "text": "Emissions from farm management dropped when the emission factor for electricity generation was based on the Brazilian matrix. In this case, the emission factor for electricity generation (0.205 kg CO" }, { - "self_ref": "#/texts/406", + "self_ref": "#/texts/619", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8209,9 +13578,9 @@ } }, { - "self_ref": "#/texts/407", + "self_ref": "#/texts/620", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8221,9 +13590,9 @@ "text": "e kWh" }, { - "self_ref": "#/texts/408", + "self_ref": "#/texts/621", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8240,9 +13609,9 @@ } }, { - "self_ref": "#/texts/409", + "self_ref": "#/texts/622", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8252,9 +13621,9 @@ "text": "[46]) is much lower than that in a LCA study conducted in US (0.73 kg CO" }, { - "self_ref": "#/texts/410", + "self_ref": "#/texts/623", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8271,9 +13640,9 @@ } }, { - "self_ref": "#/texts/411", + "self_ref": "#/texts/624", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8283,9 +13652,9 @@ "text": "e kWh" }, { - "self_ref": "#/texts/412", + "self_ref": "#/texts/625", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8302,9 +13671,9 @@ } }, { - "self_ref": "#/texts/413", + "self_ref": "#/texts/626", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8314,9 +13683,9 @@ "text": "[42]). This apparent discrepancy is explained because in 2016, almost 66% of the electricity generated in Brazil was from hydropower, which has an emission factor of 0.074 kg CO" }, { - "self_ref": "#/texts/414", + "self_ref": "#/texts/627", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8333,9 +13702,9 @@ } }, { - "self_ref": "#/texts/415", + "self_ref": "#/texts/628", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8345,9 +13714,9 @@ "text": "e kWh" }, { - "self_ref": "#/texts/416", + "self_ref": "#/texts/629", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8364,9 +13733,9 @@ } }, { - "self_ref": "#/texts/417", + "self_ref": "#/texts/630", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8376,9 +13745,9 @@ "text": "against 0.382 and 0.926 kg CO" }, { - "self_ref": "#/texts/418", + "self_ref": "#/texts/631", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8395,9 +13764,9 @@ } }, { - "self_ref": "#/texts/419", + "self_ref": "#/texts/632", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8407,9 +13776,9 @@ "text": "e kWh" }, { - "self_ref": "#/texts/420", + "self_ref": "#/texts/633", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8426,9 +13795,9 @@ } }, { - "self_ref": "#/texts/421", + "self_ref": "#/texts/634", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/139" }, "children": [], "content_layer": "body", @@ -8438,13 +13807,13 @@ "text": "produced by natural gas and hard coal, respectively [46]." }, { - "self_ref": "#/texts/422", + "self_ref": "#/texts/635", "parent": { - "$ref": "#/texts/256" + "$ref": "#/texts/469" }, "children": [ { - "$ref": "#/groups/26" + "$ref": "#/groups/140" } ], "content_layer": "body", @@ -8455,9 +13824,9 @@ "level": 2 }, { - "self_ref": "#/texts/423", + "self_ref": "#/texts/636", "parent": { - "$ref": "#/groups/26" + "$ref": "#/groups/140" }, "children": [], "content_layer": "body", @@ -8467,9 +13836,9 @@ "text": "The milk production and composition data are the average for a typical herd, which might have great animal-to-animal variability. Likewise, DM yield of crops and pastures were collected from experimental observations, and may change as a function of inter-annual variation, climatic conditions, soil type, fertilization level etc. The emission factors for direct and indirect N" }, { - "self_ref": "#/texts/424", + "self_ref": "#/texts/637", "parent": { - "$ref": "#/groups/26" + "$ref": "#/groups/140" }, "children": [], "content_layer": "body", @@ -8486,9 +13855,9 @@ } }, { - "self_ref": "#/texts/425", + "self_ref": "#/texts/638", "parent": { - "$ref": "#/groups/26" + "$ref": "#/groups/140" }, "children": [], "content_layer": "body", @@ -8498,9 +13867,9 @@ "text": "O emissions from urine and dung were alternatively estimated using local data, but more experiments are necessary to reduce the uncertainty. The CO" }, { - "self_ref": "#/texts/426", + "self_ref": "#/texts/639", "parent": { - "$ref": "#/groups/26" + "$ref": "#/groups/140" }, "children": [], "content_layer": "body", @@ -8517,9 +13886,9 @@ } }, { - "self_ref": "#/texts/427", + "self_ref": "#/texts/640", "parent": { - "$ref": "#/groups/26" + "$ref": "#/groups/140" }, "children": [], "content_layer": "body", @@ -8529,16 +13898,16 @@ "text": "emitted from lime and urea application was estimated from IPCC default values, which may not represent emissions in subtropical conditions. This LCA may be improved by reducing the uncertainty of factors for estimating emissions from excreta and feed production, including the C sequestration or emissions as a function of soil management." }, { - "self_ref": "#/texts/428", + "self_ref": "#/texts/641", "parent": { - "$ref": "#/texts/256" + "$ref": "#/texts/469" }, "children": [ { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, { - "$ref": "#/groups/28" + "$ref": "#/groups/142" } ], "content_layer": "body", @@ -8549,9 +13918,9 @@ "level": 2 }, { - "self_ref": "#/texts/429", + "self_ref": "#/texts/642", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8561,9 +13930,9 @@ "text": "The potential for using pasture can reduce the C footprint because milk production kept pace with animal confinement. However, if milk production is to decrease with lower TMR intake and inclusion of pasture [19], the C footprint would be expected to increase. Lorenz et al. [22] showed that an increase in milk yield from 5,000 to 6,000 kg ECM reduced the C footprint by 0.12 kg CO" }, { - "self_ref": "#/texts/430", + "self_ref": "#/texts/643", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8580,9 +13949,9 @@ } }, { - "self_ref": "#/texts/431", + "self_ref": "#/texts/644", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8592,9 +13961,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/432", + "self_ref": "#/texts/645", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8611,9 +13980,9 @@ } }, { - "self_ref": "#/texts/433", + "self_ref": "#/texts/646", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8623,9 +13992,9 @@ "text": ", whereas an increase from 10,000 to 11,000 kg ECM reduced the C footprint by only 0.06 kg CO" }, { - "self_ref": "#/texts/434", + "self_ref": "#/texts/647", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8642,9 +14011,9 @@ } }, { - "self_ref": "#/texts/435", + "self_ref": "#/texts/648", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8654,9 +14023,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/436", + "self_ref": "#/texts/649", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8673,9 +14042,9 @@ } }, { - "self_ref": "#/texts/437", + "self_ref": "#/texts/650", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8685,9 +14054,9 @@ "text": ". Hence, the impact of increasing milk production on decreasing C footprint is not linear, and mitigation measures, such as breeding for increased genetic yield potential and increasing concentrate ratio in the diet, are potentially harmful for animal’s health and welfare [70]. For instance, increasing concentrate ratio potentially increases the occurrence of subclinical ketosis and foot lesions, and C footprint may increase by 0.03 kg CO" }, { - "self_ref": "#/texts/438", + "self_ref": "#/texts/651", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8704,9 +14073,9 @@ } }, { - "self_ref": "#/texts/439", + "self_ref": "#/texts/652", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8716,9 +14085,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/440", + "self_ref": "#/texts/653", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8735,9 +14104,9 @@ } }, { - "self_ref": "#/texts/441", + "self_ref": "#/texts/654", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8747,9 +14116,9 @@ "text": "in subclinical ketosis [71] and by 0.02 kg CO" }, { - "self_ref": "#/texts/442", + "self_ref": "#/texts/655", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8766,9 +14135,9 @@ } }, { - "self_ref": "#/texts/443", + "self_ref": "#/texts/656", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8778,9 +14147,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/444", + "self_ref": "#/texts/657", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8797,9 +14166,9 @@ } }, { - "self_ref": "#/texts/445", + "self_ref": "#/texts/658", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/141" }, "children": [], "content_layer": "body", @@ -8809,9 +14178,9 @@ "text": "in case of foot lesions [72]." }, { - "self_ref": "#/texts/446", + "self_ref": "#/texts/659", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8821,9 +14190,9 @@ "text": "Grazing lands may also improve biodiversity [73]. Strategies such as zero tillage may increase stocks of soil C [74]. This study did not consider C sequestration during the growth of annual pastures, because it was assumed these grasses were planted with tillage, having a balance between C sequestration and C emissions [38]. Considering the C sequestration from no-tillage perennial pasture, the amount of C sequestration will more than compensates for C emitted. These results are in agreement with other authors who have shown that a reduction or elimination of soil tillage increases annual soil C sequestration in subtropical areas by 0.5 to 1.5 t ha" }, { - "self_ref": "#/texts/447", + "self_ref": "#/texts/660", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8840,9 +14209,9 @@ } }, { - "self_ref": "#/texts/448", + "self_ref": "#/texts/661", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8852,9 +14221,9 @@ "text": "[75]. If 50% of tilled areas were under perennial grasslands, 1.0 t C ha" }, { - "self_ref": "#/texts/449", + "self_ref": "#/texts/662", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8871,9 +14240,9 @@ } }, { - "self_ref": "#/texts/450", + "self_ref": "#/texts/663", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8883,9 +14252,9 @@ "text": "would be sequestered, further reducing the C footprint by 0.015 and 0.025 kg CO" }, { - "self_ref": "#/texts/451", + "self_ref": "#/texts/664", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8902,9 +14271,9 @@ } }, { - "self_ref": "#/texts/452", + "self_ref": "#/texts/665", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8914,9 +14283,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/453", + "self_ref": "#/texts/666", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8933,9 +14302,9 @@ } }, { - "self_ref": "#/texts/454", + "self_ref": "#/texts/667", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8945,9 +14314,9 @@ "text": "for the scenarios using 75 and 50% TMR, respectively. Eliminating tillage, the reduction on total GHG emissions would be 0.03 and 0.05 kg CO" }, { - "self_ref": "#/texts/455", + "self_ref": "#/texts/668", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8964,9 +14333,9 @@ } }, { - "self_ref": "#/texts/456", + "self_ref": "#/texts/669", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8976,9 +14345,9 @@ "text": "e (kg ECM)" }, { - "self_ref": "#/texts/457", + "self_ref": "#/texts/670", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -8995,9 +14364,9 @@ } }, { - "self_ref": "#/texts/458", + "self_ref": "#/texts/671", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -9007,9 +14376,9 @@ "text": "for 75 and 50% TMR, respectively. However, this approach may be controversial because lands which have been consistently managed for decades have approached steady state C storage, so that net exchange of CO" }, { - "self_ref": "#/texts/459", + "self_ref": "#/texts/672", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -9026,9 +14395,9 @@ } }, { - "self_ref": "#/texts/460", + "self_ref": "#/texts/673", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/142" }, "children": [], "content_layer": "body", @@ -9038,13 +14407,13 @@ "text": "would be negligible [76]." }, { - "self_ref": "#/texts/461", + "self_ref": "#/texts/674", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/groups/29" + "$ref": "#/groups/143" } ], "content_layer": "body", @@ -9055,9 +14424,9 @@ "level": 1 }, { - "self_ref": "#/texts/462", + "self_ref": "#/texts/675", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/143" }, "children": [], "content_layer": "body", @@ -9067,9 +14436,9 @@ "text": "This study assessed the C footprint of dairy cattle systems with or without access to pastures. Including pastures showed potential to maintain or decrease to a small extent the C footprint, which may be attributable to the evidence of low N" }, { - "self_ref": "#/texts/463", + "self_ref": "#/texts/676", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/143" }, "children": [], "content_layer": "body", @@ -9086,9 +14455,9 @@ } }, { - "self_ref": "#/texts/464", + "self_ref": "#/texts/677", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/143" }, "children": [], "content_layer": "body", @@ -9098,9 +14467,9 @@ "text": "O emissions from urine and dung in dairy systems in subtropical areas. Even though the enteric CH" }, { - "self_ref": "#/texts/465", + "self_ref": "#/texts/678", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/143" }, "children": [], "content_layer": "body", @@ -9117,9 +14486,9 @@ } }, { - "self_ref": "#/texts/466", + "self_ref": "#/texts/679", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/143" }, "children": [], "content_layer": "body", @@ -9129,9 +14498,9 @@ "text": "intensity was the largest source of CO" }, { - "self_ref": "#/texts/467", + "self_ref": "#/texts/680", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/143" }, "children": [], "content_layer": "body", @@ -9148,9 +14517,9 @@ } }, { - "self_ref": "#/texts/468", + "self_ref": "#/texts/681", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/143" }, "children": [], "content_layer": "body", @@ -9160,13 +14529,13 @@ "text": "e emissions, it did not change between different scenarios due to the narrow range of NDF content in diets and maintaining the same milk production with or without access to pastures." }, { - "self_ref": "#/texts/469", + "self_ref": "#/texts/682", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/texts/470" + "$ref": "#/texts/683" } ], "content_layer": "body", @@ -9177,9 +14546,9 @@ "level": 1 }, { - "self_ref": "#/texts/470", + "self_ref": "#/texts/683", "parent": { - "$ref": "#/texts/469" + "$ref": "#/texts/682" }, "children": [], "content_layer": "body", @@ -9189,13 +14558,13 @@ "text": "Thanks to Anna Naranjo for helpful comments throughout the elaboration of this manuscript, and to André Thaler Neto and Roberto Kappes for providing the key characteristics of the herd considered in this study." }, { - "self_ref": "#/texts/471", + "self_ref": "#/texts/684", "parent": { "$ref": "#/texts/0" }, "children": [ { - "$ref": "#/groups/30" + "$ref": "#/groups/144" } ], "content_layer": "body", @@ -9206,9 +14575,9 @@ "level": 1 }, { - "self_ref": "#/texts/472", + "self_ref": "#/texts/685", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9220,9 +14589,9 @@ "marker": "" }, { - "self_ref": "#/texts/473", + "self_ref": "#/texts/686", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9234,9 +14603,9 @@ "marker": "" }, { - "self_ref": "#/texts/474", + "self_ref": "#/texts/687", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9248,9 +14617,9 @@ "marker": "" }, { - "self_ref": "#/texts/475", + "self_ref": "#/texts/688", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9262,9 +14631,9 @@ "marker": "" }, { - "self_ref": "#/texts/476", + "self_ref": "#/texts/689", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9276,9 +14645,9 @@ "marker": "" }, { - "self_ref": "#/texts/477", + "self_ref": "#/texts/690", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9290,9 +14659,9 @@ "marker": "" }, { - "self_ref": "#/texts/478", + "self_ref": "#/texts/691", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9304,9 +14673,9 @@ "marker": "" }, { - "self_ref": "#/texts/479", + "self_ref": "#/texts/692", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9318,9 +14687,9 @@ "marker": "" }, { - "self_ref": "#/texts/480", + "self_ref": "#/texts/693", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9332,9 +14701,9 @@ "marker": "" }, { - "self_ref": "#/texts/481", + "self_ref": "#/texts/694", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9346,9 +14715,9 @@ "marker": "" }, { - "self_ref": "#/texts/482", + "self_ref": "#/texts/695", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9360,9 +14729,9 @@ "marker": "" }, { - "self_ref": "#/texts/483", + "self_ref": "#/texts/696", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9374,9 +14743,9 @@ "marker": "" }, { - "self_ref": "#/texts/484", + "self_ref": "#/texts/697", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9388,9 +14757,9 @@ "marker": "" }, { - "self_ref": "#/texts/485", + "self_ref": "#/texts/698", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9402,9 +14771,9 @@ "marker": "" }, { - "self_ref": "#/texts/486", + "self_ref": "#/texts/699", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9416,9 +14785,9 @@ "marker": "" }, { - "self_ref": "#/texts/487", + "self_ref": "#/texts/700", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9430,9 +14799,9 @@ "marker": "" }, { - "self_ref": "#/texts/488", + "self_ref": "#/texts/701", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9444,9 +14813,9 @@ "marker": "" }, { - "self_ref": "#/texts/489", + "self_ref": "#/texts/702", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9458,9 +14827,9 @@ "marker": "" }, { - "self_ref": "#/texts/490", + "self_ref": "#/texts/703", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9472,9 +14841,9 @@ "marker": "" }, { - "self_ref": "#/texts/491", + "self_ref": "#/texts/704", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9486,9 +14855,9 @@ "marker": "" }, { - "self_ref": "#/texts/492", + "self_ref": "#/texts/705", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9500,9 +14869,9 @@ "marker": "" }, { - "self_ref": "#/texts/493", + "self_ref": "#/texts/706", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9514,9 +14883,9 @@ "marker": "" }, { - "self_ref": "#/texts/494", + "self_ref": "#/texts/707", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9528,9 +14897,9 @@ "marker": "" }, { - "self_ref": "#/texts/495", + "self_ref": "#/texts/708", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9542,9 +14911,9 @@ "marker": "" }, { - "self_ref": "#/texts/496", + "self_ref": "#/texts/709", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9556,9 +14925,9 @@ "marker": "" }, { - "self_ref": "#/texts/497", + "self_ref": "#/texts/710", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9570,9 +14939,9 @@ "marker": "" }, { - "self_ref": "#/texts/498", + "self_ref": "#/texts/711", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9584,9 +14953,9 @@ "marker": "" }, { - "self_ref": "#/texts/499", + "self_ref": "#/texts/712", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9598,9 +14967,9 @@ "marker": "" }, { - "self_ref": "#/texts/500", + "self_ref": "#/texts/713", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9612,9 +14981,9 @@ "marker": "" }, { - "self_ref": "#/texts/501", + "self_ref": "#/texts/714", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9626,9 +14995,9 @@ "marker": "" }, { - "self_ref": "#/texts/502", + "self_ref": "#/texts/715", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9640,9 +15009,9 @@ "marker": "" }, { - "self_ref": "#/texts/503", + "self_ref": "#/texts/716", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9654,9 +15023,9 @@ "marker": "" }, { - "self_ref": "#/texts/504", + "self_ref": "#/texts/717", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9668,9 +15037,9 @@ "marker": "" }, { - "self_ref": "#/texts/505", + "self_ref": "#/texts/718", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9682,9 +15051,9 @@ "marker": "" }, { - "self_ref": "#/texts/506", + "self_ref": "#/texts/719", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9696,9 +15065,9 @@ "marker": "" }, { - "self_ref": "#/texts/507", + "self_ref": "#/texts/720", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9710,9 +15079,9 @@ "marker": "" }, { - "self_ref": "#/texts/508", + "self_ref": "#/texts/721", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9724,9 +15093,9 @@ "marker": "" }, { - "self_ref": "#/texts/509", + "self_ref": "#/texts/722", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9738,9 +15107,9 @@ "marker": "" }, { - "self_ref": "#/texts/510", + "self_ref": "#/texts/723", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9752,9 +15121,9 @@ "marker": "" }, { - "self_ref": "#/texts/511", + "self_ref": "#/texts/724", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9766,9 +15135,9 @@ "marker": "" }, { - "self_ref": "#/texts/512", + "self_ref": "#/texts/725", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9780,9 +15149,9 @@ "marker": "" }, { - "self_ref": "#/texts/513", + "self_ref": "#/texts/726", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9794,9 +15163,9 @@ "marker": "" }, { - "self_ref": "#/texts/514", + "self_ref": "#/texts/727", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9808,9 +15177,9 @@ "marker": "" }, { - "self_ref": "#/texts/515", + "self_ref": "#/texts/728", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9822,9 +15191,9 @@ "marker": "" }, { - "self_ref": "#/texts/516", + "self_ref": "#/texts/729", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9836,9 +15205,9 @@ "marker": "" }, { - "self_ref": "#/texts/517", + "self_ref": "#/texts/730", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9850,9 +15219,9 @@ "marker": "" }, { - "self_ref": "#/texts/518", + "self_ref": "#/texts/731", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9864,9 +15233,9 @@ "marker": "" }, { - "self_ref": "#/texts/519", + "self_ref": "#/texts/732", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9878,9 +15247,9 @@ "marker": "" }, { - "self_ref": "#/texts/520", + "self_ref": "#/texts/733", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9892,9 +15261,9 @@ "marker": "" }, { - "self_ref": "#/texts/521", + "self_ref": "#/texts/734", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9906,9 +15275,9 @@ "marker": "" }, { - "self_ref": "#/texts/522", + "self_ref": "#/texts/735", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9920,9 +15289,9 @@ "marker": "" }, { - "self_ref": "#/texts/523", + "self_ref": "#/texts/736", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9934,9 +15303,9 @@ "marker": "" }, { - "self_ref": "#/texts/524", + "self_ref": "#/texts/737", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9948,9 +15317,9 @@ "marker": "" }, { - "self_ref": "#/texts/525", + "self_ref": "#/texts/738", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9962,9 +15331,9 @@ "marker": "" }, { - "self_ref": "#/texts/526", + "self_ref": "#/texts/739", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9976,9 +15345,9 @@ "marker": "" }, { - "self_ref": "#/texts/527", + "self_ref": "#/texts/740", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -9990,9 +15359,9 @@ "marker": "" }, { - "self_ref": "#/texts/528", + "self_ref": "#/texts/741", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10004,9 +15373,9 @@ "marker": "" }, { - "self_ref": "#/texts/529", + "self_ref": "#/texts/742", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10018,9 +15387,9 @@ "marker": "" }, { - "self_ref": "#/texts/530", + "self_ref": "#/texts/743", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10032,9 +15401,9 @@ "marker": "" }, { - "self_ref": "#/texts/531", + "self_ref": "#/texts/744", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10046,9 +15415,9 @@ "marker": "" }, { - "self_ref": "#/texts/532", + "self_ref": "#/texts/745", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10060,9 +15429,9 @@ "marker": "" }, { - "self_ref": "#/texts/533", + "self_ref": "#/texts/746", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10074,9 +15443,9 @@ "marker": "" }, { - "self_ref": "#/texts/534", + "self_ref": "#/texts/747", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10088,9 +15457,9 @@ "marker": "" }, { - "self_ref": "#/texts/535", + "self_ref": "#/texts/748", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10102,9 +15471,9 @@ "marker": "" }, { - "self_ref": "#/texts/536", + "self_ref": "#/texts/749", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10116,9 +15485,9 @@ "marker": "" }, { - "self_ref": "#/texts/537", + "self_ref": "#/texts/750", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10130,9 +15499,9 @@ "marker": "" }, { - "self_ref": "#/texts/538", + "self_ref": "#/texts/751", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10144,9 +15513,9 @@ "marker": "" }, { - "self_ref": "#/texts/539", + "self_ref": "#/texts/752", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10158,9 +15527,9 @@ "marker": "" }, { - "self_ref": "#/texts/540", + "self_ref": "#/texts/753", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10172,9 +15541,9 @@ "marker": "" }, { - "self_ref": "#/texts/541", + "self_ref": "#/texts/754", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10186,9 +15555,9 @@ "marker": "" }, { - "self_ref": "#/texts/542", + "self_ref": "#/texts/755", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10200,9 +15569,9 @@ "marker": "" }, { - "self_ref": "#/texts/543", + "self_ref": "#/texts/756", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10214,9 +15583,9 @@ "marker": "" }, { - "self_ref": "#/texts/544", + "self_ref": "#/texts/757", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10228,9 +15597,9 @@ "marker": "" }, { - "self_ref": "#/texts/545", + "self_ref": "#/texts/758", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10242,9 +15611,9 @@ "marker": "" }, { - "self_ref": "#/texts/546", + "self_ref": "#/texts/759", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10256,9 +15625,9 @@ "marker": "" }, { - "self_ref": "#/texts/547", + "self_ref": "#/texts/760", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/144" }, "children": [], "content_layer": "body", @@ -10292,7 +15661,7 @@ { "self_ref": "#/pictures/1", "parent": { - "$ref": "#/texts/258" + "$ref": "#/texts/471" }, "children": [], "content_layer": "body", @@ -10300,7 +15669,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/276" + "$ref": "#/texts/489" } ], "references": [], @@ -10310,7 +15679,7 @@ { "self_ref": "#/pictures/2", "parent": { - "$ref": "#/texts/328" + "$ref": "#/texts/541" }, "children": [], "content_layer": "body", @@ -10318,7 +15687,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/342" + "$ref": "#/texts/555" } ], "references": [], @@ -10328,7 +15697,7 @@ { "self_ref": "#/pictures/3", "parent": { - "$ref": "#/texts/356" + "$ref": "#/texts/569" }, "children": [], "content_layer": "body", @@ -10336,7 +15705,7 @@ "prov": [], "captions": [ { - "$ref": "#/texts/392" + "$ref": "#/texts/605" } ], "references": [], @@ -10350,7 +15719,11 @@ "parent": { "$ref": "#/texts/50" }, - "children": [], + "children": [ + { + "$ref": "#/groups/4" + } + ], "content_layer": "body", "label": "table", "prov": [], @@ -10465,7 +15838,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/4" + } }, { "row_span": 1, @@ -11415,15 +16791,31 @@ { "self_ref": "#/tables/1", "parent": { - "$ref": "#/texts/94" + "$ref": "#/texts/96" }, - "children": [], + "children": [ + { + "$ref": "#/groups/10" + }, + { + "$ref": "#/groups/12" + }, + { + "$ref": "#/groups/14" + }, + { + "$ref": "#/groups/16" + }, + { + "$ref": "#/groups/18" + } + ], "content_layer": "body", "label": "table", "prov": [], "captions": [ { - "$ref": "#/texts/102" + "$ref": "#/texts/104" } ], "references": [], @@ -11792,7 +17184,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/10" + } }, { "row_span": 1, @@ -11935,7 +17330,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/12" + } }, { "row_span": 1, @@ -12806,7 +18204,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/14" + } }, { "row_span": 1, @@ -13690,7 +19091,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/16" + } }, { "row_span": 1, @@ -13833,7 +19237,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/18" + } }, { "row_span": 1, @@ -17022,15 +22429,52 @@ { "self_ref": "#/tables/2", "parent": { - "$ref": "#/texts/103" + "$ref": "#/texts/117" }, - "children": [], + "children": [ + { + "$ref": "#/groups/21" + }, + { + "$ref": "#/groups/23" + }, + { + "$ref": "#/groups/25" + }, + { + "$ref": "#/groups/27" + }, + { + "$ref": "#/groups/29" + }, + { + "$ref": "#/groups/31" + }, + { + "$ref": "#/groups/33" + }, + { + "$ref": "#/groups/35" + }, + { + "$ref": "#/groups/37" + }, + { + "$ref": "#/groups/39" + }, + { + "$ref": "#/groups/41" + }, + { + "$ref": "#/groups/43" + } + ], "content_layer": "body", "label": "table", "prov": [], "captions": [ { - "$ref": "#/texts/111" + "$ref": "#/texts/125" } ], "references": [], @@ -17061,7 +22505,10 @@ "column_header": true, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/21" + } }, { "row_span": 1, @@ -17087,7 +22534,10 @@ "column_header": true, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/23" + } }, { "row_span": 1, @@ -17217,7 +22667,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/25" + } }, { "row_span": 1, @@ -17282,7 +22735,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/27" + } }, { "row_span": 1, @@ -17373,7 +22829,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/29" + } }, { "row_span": 1, @@ -17412,7 +22871,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/31" + } }, { "row_span": 1, @@ -17438,7 +22900,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/33" + } }, { "row_span": 1, @@ -17477,7 +22942,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/35" + } }, { "row_span": 1, @@ -17503,7 +22971,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/37" + } }, { "row_span": 1, @@ -17542,7 +23013,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/39" + } }, { "row_span": 1, @@ -17568,7 +23042,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/41" + } }, { "row_span": 1, @@ -17607,7 +23084,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/43" + } }, { "row_span": 1, @@ -18237,15 +23717,94 @@ { "self_ref": "#/tables/3", "parent": { - "$ref": "#/texts/103" + "$ref": "#/texts/117" }, - "children": [], + "children": [ + { + "$ref": "#/groups/46" + }, + { + "$ref": "#/groups/48" + }, + { + "$ref": "#/groups/50" + }, + { + "$ref": "#/groups/52" + }, + { + "$ref": "#/groups/54" + }, + { + "$ref": "#/groups/56" + }, + { + "$ref": "#/groups/58" + }, + { + "$ref": "#/groups/60" + }, + { + "$ref": "#/groups/62" + }, + { + "$ref": "#/groups/64" + }, + { + "$ref": "#/groups/66" + }, + { + "$ref": "#/groups/68" + }, + { + "$ref": "#/groups/70" + }, + { + "$ref": "#/groups/72" + }, + { + "$ref": "#/groups/74" + }, + { + "$ref": "#/groups/76" + }, + { + "$ref": "#/groups/78" + }, + { + "$ref": "#/groups/80" + }, + { + "$ref": "#/groups/82" + }, + { + "$ref": "#/groups/84" + }, + { + "$ref": "#/groups/86" + }, + { + "$ref": "#/groups/88" + }, + { + "$ref": "#/groups/90" + }, + { + "$ref": "#/groups/92" + }, + { + "$ref": "#/groups/94" + }, + { + "$ref": "#/groups/96" + } + ], "content_layer": "body", "label": "table", "prov": [], "captions": [ { - "$ref": "#/texts/143" + "$ref": "#/texts/194" } ], "references": [], @@ -18328,7 +23887,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/46" + } }, { "row_span": 1, @@ -18393,7 +23955,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/48" + } }, { "row_span": 1, @@ -18458,7 +24023,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/50" + } }, { "row_span": 1, @@ -18588,7 +24156,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/52" + } }, { "row_span": 1, @@ -18653,7 +24224,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/54" + } }, { "row_span": 1, @@ -18718,7 +24292,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/56" + } }, { "row_span": 1, @@ -18783,7 +24360,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/58" + } }, { "row_span": 1, @@ -18848,7 +24428,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/60" + } }, { "row_span": 1, @@ -18913,7 +24496,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/62" + } }, { "row_span": 1, @@ -18978,7 +24564,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/64" + } }, { "row_span": 1, @@ -19043,7 +24632,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/66" + } }, { "row_span": 1, @@ -19108,7 +24700,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/68" + } }, { "row_span": 1, @@ -19173,7 +24768,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/70" + } }, { "row_span": 1, @@ -19238,7 +24836,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/72" + } }, { "row_span": 1, @@ -19303,7 +24904,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/74" + } }, { "row_span": 1, @@ -19368,7 +24972,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/76" + } }, { "row_span": 1, @@ -19433,7 +25040,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/78" + } }, { "row_span": 1, @@ -19498,7 +25108,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/80" + } }, { "row_span": 1, @@ -19563,7 +25176,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/82" + } }, { "row_span": 1, @@ -19628,7 +25244,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/84" + } }, { "row_span": 1, @@ -19693,7 +25312,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/86" + } }, { "row_span": 1, @@ -19758,7 +25380,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/88" + } }, { "row_span": 1, @@ -19823,7 +25448,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/90" + } }, { "row_span": 1, @@ -19888,7 +25516,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/92" + } }, { "row_span": 1, @@ -19953,7 +25584,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/94" + } }, { "row_span": 1, @@ -20018,7 +25652,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/96" + } }, { "row_span": 1, @@ -21960,15 +27597,55 @@ { "self_ref": "#/tables/4", "parent": { - "$ref": "#/texts/208" + "$ref": "#/texts/385" }, - "children": [], + "children": [ + { + "$ref": "#/groups/101" + }, + { + "$ref": "#/groups/103" + }, + { + "$ref": "#/groups/105" + }, + { + "$ref": "#/groups/107" + }, + { + "$ref": "#/groups/109" + }, + { + "$ref": "#/groups/111" + }, + { + "$ref": "#/groups/113" + }, + { + "$ref": "#/groups/115" + }, + { + "$ref": "#/groups/117" + }, + { + "$ref": "#/groups/119" + }, + { + "$ref": "#/groups/121" + }, + { + "$ref": "#/groups/123" + }, + { + "$ref": "#/groups/125" + } + ], "content_layer": "body", "label": "table", "prov": [], "captions": [ { - "$ref": "#/texts/210" + "$ref": "#/texts/387" } ], "references": [], @@ -22012,7 +27689,10 @@ "column_header": true, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/101" + } }, { "row_span": 1, @@ -22064,7 +27744,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/103" + } }, { "row_span": 1, @@ -22116,7 +27799,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/105" + } }, { "row_span": 1, @@ -22142,7 +27828,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/107" + } }, { "row_span": 1, @@ -22168,7 +27857,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/109" + } }, { "row_span": 1, @@ -22194,7 +27886,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/111" + } }, { "row_span": 1, @@ -22220,7 +27915,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/113" + } }, { "row_span": 1, @@ -22272,7 +27970,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/115" + } }, { "row_span": 1, @@ -22376,7 +28077,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/117" + } }, { "row_span": 1, @@ -22428,7 +28132,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/119" + } }, { "row_span": 1, @@ -22532,7 +28239,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/121" + } }, { "row_span": 1, @@ -22558,7 +28268,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/123" + } }, { "row_span": 1, @@ -22584,7 +28297,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/125" + } }, { "row_span": 1, diff --git a/tests/data/jats/groundtruth/pone.0234687.nxml.md b/tests/data/jats/groundtruth/pone.0234687.nxml.md index 098b61f1a6..e140406be2 100644 --- a/tests/data/jats/groundtruth/pone.0234687.nxml.md +++ b/tests/data/jats/groundtruth/pone.0234687.nxml.md @@ -43,7 +43,7 @@ Table 1 Descriptive characteristics of the herd. | Item | Unit | Average | | - | - | - | | Milking cows | # | 165 | -| Milk production | kg year-1 | 7,015 | +| Milk production | kg year -1 | 7,015 | | Milk fat | % | 4.0 | | Milk protein | % | 3.3 | | Length of lactation | days | 305 | @@ -76,15 +76,15 @@ Table 2 Dairy cows’ diets in different scenariosa. | | Calf - 0–12 mo | Calf - 12-AI mo | Pregnant/dry - Heifer | Pregnant/dry - Cow | Lactation - TMR | Lactation - TMR75 | Lactation - TMR50 | Weighted average - TMR | Weighted average - TMR75 | Weighted average - TMR50 | | - | - | - | - | - | - | - | - | - | - | - | | Days | 360 | 120 | 270 | 180 | 1220 | 1220 | 1220 | | | | -| DM intake, kg d-1 | 3.35 | 6.90 | 10.4 | 11.0 | 18.7 | 17.2 | 17.0 | 13.8 | 12.9 | 12.8 | -| Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | Ingredients, g (kg DM)-1 | +| DM intake, kg d -1 | 3.35 | 6.90 | 10.4 | 11.0 | 18.7 | 17.2 | 17.0 | 13.8 | 12.9 | 12.8 | +| Ingredients, g (kg DM) -1 | | | | | | | | | | | | Ground corn | 309 | 145 | 96.3 | - | 257 | 195 | 142 | 218 | 183 | 153 | | Soybean meal | 138 | 22 | 26.7 | - | 143 | 105 | 76.1 | 109 | 88.0 | 71.0 | | Corn silage | 149 | 290 | 85.6 | - | 601 | 451 | 326 | 393 | 308 | 237 | | Ann temperate pasture | 184 | 326 | 257 | - | - | 185 | 337 | 81.3 | 186 | 273 | | Ann tropical pasture | - | - | 107 | - | - | 63 | 119 | 13.4 | 49.1 | 81.0 | | Perenn tropical pasture | 219 | 217 | 428 | 1000 | - | - | - | 186 | 186 | 186 | -| Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | Chemical composition, g (kg DM)-1 | +| Chemical composition, g (kg DM) -1 | | | | | | | | | | | | Organic matter | 935 | 924 | 913 | 916 | 958 | 939 | 924 | 943 | 932 | 924 | | Crude protein | 216 | 183 | 213 | 200 | 150 | 170 | 198 | 175 | 186 | 202 | | Neutral detergent fibre | 299 | 479 | 518 | 625 | 382 | 418 | 449 | 411 | 431 | 449 | @@ -92,8 +92,8 @@ Table 2 Dairy cows’ diets in different scenariosa. | Ether extract | 46.5 | 30.4 | 28.6 | 25.0 | 31.8 | 31.1 | 30.4 | 33.2 | 32.8 | 32.4 | | Nutritive value | Nutritive value | Nutritive value | Nutritive value | Nutritive value | Nutritive value | Nutritive value | Nutritive value | Nutritive value | Nutritive value | Nutritive value | | OM digestibility, % | 82.1 | 77.9 | 77.1 | 71.9 | 72.4 | 75.0 | 77.2 | 74.8 | 76.3 | 77.6 | -| NEL, Mcal (kg DM)-1 | 1.96 | 1.69 | 1.63 | 1.44 | 1.81 | 1.78 | 1.74 | 1.8 | 1.8 | 1.7 | -| MP, g (kg DM)-1 | 111 | 93.6 | 97.6 | 90.0 | 95.0 | 102 | 102 | 97.5 | 102 | 101 | +| NE L , Mcal (kg DM) -1 | 1.96 | 1.69 | 1.63 | 1.44 | 1.81 | 1.78 | 1.74 | 1.8 | 1.8 | 1.7 | +| MP, g (kg DM) -1 | 111 | 93.6 | 97.6 | 90.0 | 95.0 | 102 | 102 | 97.5 | 102 | 101 | #### GHG emissions from crop and pasture production @@ -101,16 +101,16 @@ GHG emission factors used for off- and on-farm feed production were based on lit Table 3 GHG emission factors for Off- and On-farm feed production. -| Feed | DM yield (kg ha-1) | Emission factor | Unita | References | +| Feed | DM yield (kg ha -1 ) | Emission factor | Unit a | References | | - | - | - | - | - | | Off-farm | | | | | -| Corn grain | 7,500 | 0.316 | kg CO2e (kg grain)-1 | [30] | -| Soybean | 2,200 | 0.186 | kg CO2e (kg grain)-1 | [31] | +| Corn grain | 7,500 | 0.316 | kg CO 2 e (kg grain) -1 | [30] | +| Soybean | 2,200 | 0.186 | kg CO 2 e (kg grain) -1 | [31] | | On-farm | | | | | -| Corn silageb | 16,000 | 0.206 | kg CO2e (kg DM)-1 | [32,33] | -| Annual ryegrassc | 9,500 | 0.226 | kg CO2e (kg DM)-1 | [32,34] | -| Pearl milletd | 11,000 | 0.195 | kg CO2e (kg DM)-1 | [32,35] | -| Kikuyu grasse | 9,500 | 0.226 | kg CO2e (kg DM)-1 | [32,36] | +| Corn silage b | 16,000 | 0.206 | kg CO 2 e (kg DM) -1 | [32,33] | +| Annual ryegrass c | 9,500 | 0.226 | kg CO 2 e (kg DM) -1 | [32,34] | +| Pearl millet d | 11,000 | 0.195 | kg CO 2 e (kg DM) -1 | [32,35] | +| Kikuyu grass e | 9,500 | 0.226 | kg CO 2 e (kg DM) -1 | [32,36] | Emissions from on-farm feed production (corn silage and pasture) were estimated using primary and secondary sources based on the actual amount of each input (Table 4). Primary sources were direct and indirect N 2 O-N emissions from organic and synthetic fertilizers and crop/pasture residues, CO 2 -C emissions from lime and urea applications, as well as fuel combustion. The direct N 2 O-N emission factor (kg (kg N input) -1 ) is based on a local study performed previously [37]. For indirect N 2 O-N emissions (kg N 2 O-N (kg NH 3 -N + NO x ) -1 ), as well as CO 2 -C emissions from lime + urea, default values proposed by IPCC [38] were used. For perennial pastures, a C sequestration of 0.57 t ha -1 was used based on a 9-year study conducted in southern Brazil [39]. Due to the use of conventional tillage, no C sequestration was considered for annual pastures. The amount of fuel required was 8.9 (no-tillage) and 14.3 L ha -1 (disking) for annual tropical and temperate pastures, respectively [40]. The CO 2 from fuel combustion was 2.7 kg CO 2 L -1 [41]. Secondary sources of emissions during the production of fuel, machinery, fertilizer, pesticides, seeds and plastic for ensilage were estimated using emission factors described by Rotz et al. [42]. @@ -118,33 +118,33 @@ Table 4 GHG emissions from On-farm feed production. | Item | Corn silage | Annual temperate pasture | Annual tropical pasture | Perennial tropical pasture | | - | - | - | - | - | -| DM yield, kg ha-1 | 16000 | 9500 | 11000 | 9500 | -| Direct N2O emissions to air | | | | | -| N organic fertilizer, kg ha-1a | 150 | 180 | 225 | 225 | +| DM yield, kg ha -1 | 16000 | 9500 | 11000 | 9500 | +| Direct N 2 O emissions to air | | | | | +| N organic fertilizer, kg ha -1 a | 150 | 180 | 225 | 225 | | N synthetic fertilizer | - | 20 | 25 | 25 | -| N from residual DM, kg ha-1b | 70 | 112 | 129 | 112 | -| Emission fator, kg N2O-N (kg N)-1c | 0.002 | 0.002 | 0.002 | 0.002 | -| kg N2O ha-1 from direct emissions | 0.69 | 0.98 | 1.19 | 1.14 | -| Indirect N2O emissions to air | | | | | -| kg NH3-N+NOx-N (kg organic N)-1b | 0.2 | 0.2 | 0.2 | 0.2 | -| kg NH3-N+NOx-N (kg synthetic N)-1b | 0.1 | 0.1 | 0.1 | 0.1 | -| kg N2O-N (kg NH3-N+NOx-N)-1b | 0.01 | 0.01 | 0.01 | 0.01 | -| kg N2O ha-1 from NH3+NOx volatilized | 0.47 | 0.60 | 0.75 | 0.75 | -| Indirect N2O emissions to soil | | | | | -| kg N losses by leaching (kg N)-1b | 0.3 | 0.3 | 0.3 | 0.3 | -| kg N2O-N (kg N leaching)-1 | 0.0075 | 0.0075 | 0.0075 | 0.0075 | -| kg N2O ha-1 from N losses by leaching | 0.78 | 1.10 | 1.34 | 1.28 | -| kg N2O ha-1 (direct + indirect emissions) | 1.94 | 2.68 | 3.28 | 3.16 | -| kg CO2e ha-1 from N20 emissionsd | 514 | 710 | 869 | 838 | -| kg CO2 ha-1 from lime+ureab | 515 | 721 | 882 | 852 | -| kg CO2 ha-1 from diesel combustione | 802 | 38 | 23 | 12 | -| kg CO2e from secondary sourcesf | 516 | 205 | 225 | 284 | -| Total CO2e emitted, kg ha-1 | 1833 | 964 | 1130 | 1148 | -| Emission factor, kg CO2e (kg DM)-1g | 0.115 | 0.145 | 0.147 | 0.173 | -| Carbon sequestered, kg ha-1h | - | - | - | 570 | -| Sequestered CO2-C, kg ha-1 | - | - | - | 1393 | -| kg CO2e ha-1 (emitted—sequestered) | 1833 | 964 | 1130 | -245 | -| Emission factor, kg CO2e (kg DM)-1i | 0.115 | 0.145 | 0.147 | -0.037 | +| N from residual DM, kg ha -1 b | 70 | 112 | 129 | 112 | +| Emission fator, kg N 2 O-N (kg N) -1 c | 0.002 | 0.002 | 0.002 | 0.002 | +| kg N 2 O ha -1 from direct emissions | 0.69 | 0.98 | 1.19 | 1.14 | +| Indirect N 2 O emissions to air | | | | | +| kg NH 3 -N+NO x -N (kg organic N) -1 b | 0.2 | 0.2 | 0.2 | 0.2 | +| kg NH 3 -N+NO x -N (kg synthetic N) -1 b | 0.1 | 0.1 | 0.1 | 0.1 | +| kg N 2 O-N (kg NH 3 -N+NO x -N) -1 b | 0.01 | 0.01 | 0.01 | 0.01 | +| kg N 2 O ha -1 from NH 3 +NO x volatilized | 0.47 | 0.60 | 0.75 | 0.75 | +| Indirect N 2 O emissions to soil | | | | | +| kg N losses by leaching (kg N) -1 b | 0.3 | 0.3 | 0.3 | 0.3 | +| kg N 2 O-N (kg N leaching) -1 | 0.0075 | 0.0075 | 0.0075 | 0.0075 | +| kg N 2 O ha -1 from N losses by leaching | 0.78 | 1.10 | 1.34 | 1.28 | +| kg N 2 O ha -1 (direct + indirect emissions) | 1.94 | 2.68 | 3.28 | 3.16 | +| kg CO 2 e ha -1 from N 2 0 emissions d | 514 | 710 | 869 | 838 | +| kg CO 2 ha -1 from lime+urea b | 515 | 721 | 882 | 852 | +| kg CO 2 ha -1 from diesel combustion e | 802 | 38 | 23 | 12 | +| kg CO 2 e from secondary sources f | 516 | 205 | 225 | 284 | +| Total CO 2 e emitted, kg ha -1 | 1833 | 964 | 1130 | 1148 | +| Emission factor, kg CO 2 e (kg DM) -1 g | 0.115 | 0.145 | 0.147 | 0.173 | +| Carbon sequestered, kg ha -1 h | - | - | - | 570 | +| Sequestered CO 2 -C, kg ha -1 | - | - | - | 1393 | +| kg CO 2 e ha -1 (emitted—sequestered) | 1833 | 964 | 1130 | -245 | +| Emission factor, kg CO 2 e (kg DM) -1 i | 0.115 | 0.145 | 0.147 | -0.037 | ### Animal husbandry @@ -164,19 +164,19 @@ Emissions due to farm management included those from fuel and machinery for manu Table 5 Factors for major resource inputs in farm management. -| Item | Factor | Unita | References | +| Item | Factor | Unit a | References | | - | - | - | - | -| Production and transport of diesel | 0.374 | kg CO2e L-1 | [41] | -| Emissions from diesel fuel combustion | 2.637 | kg CO2e L-1 | [41] | -| Production of electricityb | 0.73 | kg CO2e kWh-1 | [41] | -| Production of electricity (alternative)c | 0.205 | kg CO2e kWh-1 | [46] | -| Production of machinery | 3.54 | kg CO2e (kg mm)-1 | [42] | +| Production and transport of diesel | 0.374 | kg CO 2 e L -1 | [41] | +| Emissions from diesel fuel combustion | 2.637 | kg CO 2 e L -1 | [41] | +| Production of electricity b | 0.73 | kg CO 2 e kWh -1 | [41] | +| Production of electricity (alternative) c | 0.205 | kg CO 2 e kWh -1 | [46] | +| Production of machinery | 3.54 | kg CO 2 e (kg mm) -1 | [42] | | Manure handling | | | | -| Fuel for manure handling | 0.600 | L diesel tonne-1 | [42] | -| Machinery for manure handling | 0.17 | kg mm kg-1 | [42] | +| Fuel for manure handling | 0.600 | L diesel tonne -1 | [42] | +| Machinery for manure handling | 0.17 | kg mm kg -1 | [42] | | Milking and confinement | | | | -| Electricity for milking | 0.06 | kWh (kg milk)-1 | [47] | -| Electricity for lightingd | 75 | kWh cow-1 | [47] | +| Electricity for milking | 0.06 | kWh (kg milk) -1 | [47] | +| Electricity for lighting d | 75 | kWh cow -1 | [47] | The amount of fuel use for manure handling were estimated taking into consideration the amount of manure produced per cow and the amounts of fuel required for manure handling (L diesel t -1 ) [42]. The amount of manure was estimated from OM excretions (kg cow -1 ), assuming that the manure has 8% ash on DM basis and 60% DM content. The OM excretions were calculated by NDOMI × days in confinement × proportion of daily time that animals stayed on confinement. diff --git a/tests/data/odf/groundtruth/text_document_03.odt.html b/tests/data/odf/groundtruth/text_document_03.odt.html index e6c1a3393f..e746d7c4d3 100644 --- a/tests/data/odf/groundtruth/text_document_03.odt.html +++ b/tests/data/odf/groundtruth/text_document_03.odt.html @@ -196,17 +196,17 @@

    Table with rich cells

  • Number one
  • Number two
  • Number three
    • -    		This is simple text with bold, strikethrough and italic formatting with x2 and H2O

    This is a paragraph

    +    		This is simple text with bold , strikethrough and italic formatting with x 2 and H 2 O

    This is a paragraph

    This is another paragraph

    Table with nested table

    Before table

    -
    Column AColumn B
    Simple cell upper leftSimple cell with bold and italic text
    ABC
    Cell 1Cell 2Cell 3

    Rich cell
    A nested table

    -
    ABC
    Cell 1Cell 2Cell 3
    +
    Column AColumn B
    Simple cell upper leftSimple cell with bold and italic text
    ABC

    Cell 1

    		Cell 2Cell 3

    Rich cell
    A nested table

    +
    ABC

    Cell 1

    		Cell 2Cell 3
    After table with bold , underline , strikethrough , and italic formatting

    Table with pictures

    -
    Column AColumn B
    Only text
    +
    Column AColumn B
    Only text

    Owner avatar

    Text and picture

    -
    +

    Owner avatar

    Lists with same numId in different cells

    +
      diff --git a/tests/data/odf/groundtruth/text_document_03.odt.itxt b/tests/data/odf/groundtruth/text_document_03.odt.itxt index 313af5e5a6..6bc9a7ba03 100644 --- a/tests/data/odf/groundtruth/text_document_03.odt.itxt +++ b/tests/data/odf/groundtruth/text_document_03.odt.itxt @@ -31,78 +31,102 @@ Second Paragraph item-28 at level 4: list_item: Number one item-29 at level 4: list_item: Number two item-30 at level 4: list_item: Number three - item-31 at level 2: unspecified: group rich_cell_group_0_0_3 - item-32 at level 3: text: This is a paragraph - item-33 at level 3: text: This is another paragraph - item-34 at level 1: section_header: Table with nested table - item-35 at level 1: text: Before table - item-36 at level 1: table with [3x2] - item-37 at level 2: unspecified: group rich_cell_group_1_0_2 - item-38 at level 3: table with [2x3] - item-39 at level 2: unspecified: group rich_cell_group_2_1_2 - item-40 at level 3: text: Rich cell + item-31 at level 2: unspecified: group rich_cell_group_0_1_2 + item-32 at level 3: inline: group group + item-33 at level 4: text: This is simple text with + item-34 at level 4: text: bold + item-35 at level 4: text: , + item-36 at level 4: text: strikethrough + item-37 at level 4: text: and + item-38 at level 4: text: italic + item-39 at level 4: text: formatting with x + item-40 at level 4: text: 2 + item-41 at level 4: text: and H + item-42 at level 4: text: 2 + item-43 at level 4: text: O + item-44 at level 2: unspecified: group rich_cell_group_0_0_3 + item-45 at level 3: text: This is a paragraph + item-46 at level 3: text: This is another paragraph + item-47 at level 1: section_header: Table with nested table + item-48 at level 1: text: Before table + item-49 at level 1: table with [3x2] + item-50 at level 2: unspecified: group rich_cell_group_1_1_1 + item-51 at level 3: inline: group group + item-52 at level 4: text: Simple cell with + item-53 at level 4: text: bold + item-54 at level 4: text: and + item-55 at level 4: text: italic + item-56 at level 4: text: text + item-57 at level 2: unspecified: group rich_cell_group_1_0_2 + item-58 at level 3: table with [2x3] + item-59 at level 4: unspecified: group rich_cell_group_2_0_1 + item-60 at level 5: text: Cell 1 + item-61 at level 2: unspecified: group rich_cell_group_2_1_2 + item-62 at level 3: text: Rich cell A nested table - item-41 at level 3: table with [2x3] - item-42 at level 1: inline: group group - item-43 at level 2: text: After table with - item-44 at level 2: text: bold - item-45 at level 2: text: , - item-46 at level 2: text: underline - item-47 at level 2: text: , - item-48 at level 2: text: strikethrough - item-49 at level 2: text: , and - item-50 at level 2: text: italic - item-51 at level 2: text: formatting - item-52 at level 1: section_header: Table with pictures - item-53 at level 1: table with [3x2] - item-54 at level 2: unspecified: group rich_cell_group_4_1_1 - item-55 at level 3: picture - item-56 at level 3: text: Owner avatar - item-57 at level 2: unspecified: group rich_cell_group_4_0_2 - item-58 at level 3: text: Text and picture - item-59 at level 3: picture - item-60 at level 3: text: Owner avatar - item-61 at level 1: section_header: Lists with same numId in different cells - item-62 at level 1: table with [2x1] - item-63 at level 2: unspecified: group rich_cell_group_5_0_0 - item-64 at level 3: list: group list - item-65 at level 4: list_item: Cell 1 item 1 - item-66 at level 4: list_item: Cell 1 item 2 - item-67 at level 2: unspecified: group rich_cell_group_5_0_1 - item-68 at level 3: list: group list - item-69 at level 4: list_item: Cell 2 item 1 - item-70 at level 4: list_item: Cell 2 item 2 - item-71 at level 1: section_header: Lists with different numIds in different cells - item-72 at level 1: table with [2x1] - item-73 at level 2: unspecified: group rich_cell_group_6_0_0 - item-74 at level 3: list: group list - item-75 at level 4: list_item: Cell 1 item 1 - item-76 at level 4: list_item: Cell 1 item 2 - item-77 at level 2: unspecified: group rich_cell_group_6_0_1 - item-78 at level 3: list: group list - item-79 at level 4: list_item: Cell 2 item 1 - item-80 at level 4: list_item: Cell 2 item 2 - item-81 at level 1: section_header: Multiple columns with lists - item-82 at level 1: table with [2x2] - item-83 at level 2: unspecified: group rich_cell_group_7_0_0 - item-84 at level 3: list: group list - item-85 at level 4: list_item: R1C1 item 1 - item-86 at level 4: list_item: R1C1 item 2 - item-87 at level 2: unspecified: group rich_cell_group_7_1_0 + item-63 at level 3: table with [2x3] + item-64 at level 4: unspecified: group rich_cell_group_3_0_1 + item-65 at level 5: text: Cell 1 + item-66 at level 1: inline: group group + item-67 at level 2: text: After table with + item-68 at level 2: text: bold + item-69 at level 2: text: , + item-70 at level 2: text: underline + item-71 at level 2: text: , + item-72 at level 2: text: strikethrough + item-73 at level 2: text: , and + item-74 at level 2: text: italic + item-75 at level 2: text: formatting + item-76 at level 1: section_header: Table with pictures + item-77 at level 1: table with [3x2] + item-78 at level 2: unspecified: group rich_cell_group_4_1_1 + item-79 at level 3: picture + item-80 at level 3: text: Owner avatar + item-81 at level 2: unspecified: group rich_cell_group_4_0_2 + item-82 at level 3: text: Text and picture + item-83 at level 3: picture + item-84 at level 3: text: Owner avatar + item-85 at level 1: section_header: Lists with same numId in different cells + item-86 at level 1: table with [2x1] + item-87 at level 2: unspecified: group rich_cell_group_5_0_0 item-88 at level 3: list: group list - item-89 at level 4: list_item: R1C2 item 1 - item-90 at level 4: list_item: R1C2 item 2 - item-91 at level 2: unspecified: group rich_cell_group_7_0_1 + item-89 at level 4: list_item: Cell 1 item 1 + item-90 at level 4: list_item: Cell 1 item 2 + item-91 at level 2: unspecified: group rich_cell_group_5_0_1 item-92 at level 3: list: group list - item-93 at level 4: list_item: R2C1 item 1 - item-94 at level 4: list_item: R2C1 item 2 - item-95 at level 2: unspecified: group rich_cell_group_7_1_1 - item-96 at level 3: list: group list - item-97 at level 4: list_item: R2C2 item 1 - item-98 at level 4: list_item: R2C2 item 2 - item-99 at level 1: section_header: Mixed content - list and regular text in different cells - item-100 at level 1: table with [2x1] - item-101 at level 2: unspecified: group rich_cell_group_8_0_0 + item-93 at level 4: list_item: Cell 2 item 1 + item-94 at level 4: list_item: Cell 2 item 2 + item-95 at level 1: section_header: Lists with different numIds in different cells + item-96 at level 1: table with [2x1] + item-97 at level 2: unspecified: group rich_cell_group_6_0_0 + item-98 at level 3: list: group list + item-99 at level 4: list_item: Cell 1 item 1 + item-100 at level 4: list_item: Cell 1 item 2 + item-101 at level 2: unspecified: group rich_cell_group_6_0_1 item-102 at level 3: list: group list - item-103 at level 4: list_item: List item 1 - item-104 at level 4: list_item: List item 2 \ No newline at end of file + item-103 at level 4: list_item: Cell 2 item 1 + item-104 at level 4: list_item: Cell 2 item 2 + item-105 at level 1: section_header: Multiple columns with lists + item-106 at level 1: table with [2x2] + item-107 at level 2: unspecified: group rich_cell_group_7_0_0 + item-108 at level 3: list: group list + item-109 at level 4: list_item: R1C1 item 1 + item-110 at level 4: list_item: R1C1 item 2 + item-111 at level 2: unspecified: group rich_cell_group_7_1_0 + item-112 at level 3: list: group list + item-113 at level 4: list_item: R1C2 item 1 + item-114 at level 4: list_item: R1C2 item 2 + item-115 at level 2: unspecified: group rich_cell_group_7_0_1 + item-116 at level 3: list: group list + item-117 at level 4: list_item: R2C1 item 1 + item-118 at level 4: list_item: R2C1 item 2 + item-119 at level 2: unspecified: group rich_cell_group_7_1_1 + item-120 at level 3: list: group list + item-121 at level 4: list_item: R2C2 item 1 + item-122 at level 4: list_item: R2C2 item 2 + item-123 at level 1: section_header: Mixed content - list and regular text in different cells + item-124 at level 1: table with [2x1] + item-125 at level 2: unspecified: group rich_cell_group_8_0_0 + item-126 at level 3: list: group list + item-127 at level 4: list_item: List item 1 + item-128 at level 4: list_item: List item 2 \ No newline at end of file diff --git a/tests/data/odf/groundtruth/text_document_03.odt.json b/tests/data/odf/groundtruth/text_document_03.odt.json index fd76de43a3..0df4c7f122 100644 --- a/tests/data/odf/groundtruth/text_document_03.odt.json +++ b/tests/data/odf/groundtruth/text_document_03.odt.json @@ -24,43 +24,43 @@ "$ref": "#/tables/0" }, { - "$ref": "#/texts/22" + "$ref": "#/texts/33" }, { - "$ref": "#/texts/23" + "$ref": "#/texts/34" }, { "$ref": "#/tables/1" }, { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, { - "$ref": "#/texts/34" + "$ref": "#/texts/52" }, { "$ref": "#/tables/4" }, { - "$ref": "#/texts/38" + "$ref": "#/texts/56" }, { "$ref": "#/tables/5" }, { - "$ref": "#/texts/43" + "$ref": "#/texts/61" }, { "$ref": "#/tables/6" }, { - "$ref": "#/texts/48" + "$ref": "#/texts/66" }, { "$ref": "#/tables/7" }, { - "$ref": "#/texts/57" + "$ref": "#/texts/75" }, { "$ref": "#/tables/8" @@ -241,12 +241,70 @@ "parent": { "$ref": "#/tables/0" }, + "children": [ + { + "$ref": "#/groups/10" + } + ], + "content_layer": "body", + "name": "rich_cell_group_0_1_2", + "label": "unspecified" + }, + { + "self_ref": "#/groups/10", + "parent": { + "$ref": "#/groups/9" + }, "children": [ { "$ref": "#/texts/20" }, { "$ref": "#/texts/21" + }, + { + "$ref": "#/texts/22" + }, + { + "$ref": "#/texts/23" + }, + { + "$ref": "#/texts/24" + }, + { + "$ref": "#/texts/25" + }, + { + "$ref": "#/texts/26" + }, + { + "$ref": "#/texts/27" + }, + { + "$ref": "#/texts/28" + }, + { + "$ref": "#/texts/29" + }, + { + "$ref": "#/texts/30" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/11", + "parent": { + "$ref": "#/tables/0" + }, + "children": [ + { + "$ref": "#/texts/31" + }, + { + "$ref": "#/texts/32" } ], "content_layer": "body", @@ -254,7 +312,47 @@ "label": "unspecified" }, { - "self_ref": "#/groups/10", + "self_ref": "#/groups/12", + "parent": { + "$ref": "#/tables/1" + }, + "children": [ + { + "$ref": "#/groups/13" + } + ], + "content_layer": "body", + "name": "rich_cell_group_1_1_1", + "label": "unspecified" + }, + { + "self_ref": "#/groups/13", + "parent": { + "$ref": "#/groups/12" + }, + "children": [ + { + "$ref": "#/texts/35" + }, + { + "$ref": "#/texts/36" + }, + { + "$ref": "#/texts/37" + }, + { + "$ref": "#/texts/38" + }, + { + "$ref": "#/texts/39" + } + ], + "content_layer": "body", + "name": "group", + "label": "inline" + }, + { + "self_ref": "#/groups/14", "parent": { "$ref": "#/tables/1" }, @@ -268,13 +366,27 @@ "label": "unspecified" }, { - "self_ref": "#/groups/11", + "self_ref": "#/groups/15", + "parent": { + "$ref": "#/tables/2" + }, + "children": [ + { + "$ref": "#/texts/40" + } + ], + "content_layer": "body", + "name": "rich_cell_group_2_0_1", + "label": "unspecified" + }, + { + "self_ref": "#/groups/16", "parent": { "$ref": "#/tables/1" }, "children": [ { - "$ref": "#/texts/24" + "$ref": "#/texts/41" }, { "$ref": "#/tables/3" @@ -285,37 +397,51 @@ "label": "unspecified" }, { - "self_ref": "#/groups/12", + "self_ref": "#/groups/17", + "parent": { + "$ref": "#/tables/3" + }, + "children": [ + { + "$ref": "#/texts/42" + } + ], + "content_layer": "body", + "name": "rich_cell_group_3_0_1", + "label": "unspecified" + }, + { + "self_ref": "#/groups/18", "parent": { "$ref": "#/body" }, "children": [ { - "$ref": "#/texts/25" + "$ref": "#/texts/43" }, { - "$ref": "#/texts/26" + "$ref": "#/texts/44" }, { - "$ref": "#/texts/27" + "$ref": "#/texts/45" }, { - "$ref": "#/texts/28" + "$ref": "#/texts/46" }, { - "$ref": "#/texts/29" + "$ref": "#/texts/47" }, { - "$ref": "#/texts/30" + "$ref": "#/texts/48" }, { - "$ref": "#/texts/31" + "$ref": "#/texts/49" }, { - "$ref": "#/texts/32" + "$ref": "#/texts/50" }, { - "$ref": "#/texts/33" + "$ref": "#/texts/51" } ], "content_layer": "body", @@ -323,7 +449,7 @@ "label": "inline" }, { - "self_ref": "#/groups/13", + "self_ref": "#/groups/19", "parent": { "$ref": "#/tables/4" }, @@ -332,7 +458,7 @@ "$ref": "#/pictures/0" }, { - "$ref": "#/texts/35" + "$ref": "#/texts/53" } ], "content_layer": "body", @@ -340,19 +466,19 @@ "label": "unspecified" }, { - "self_ref": "#/groups/14", + "self_ref": "#/groups/20", "parent": { "$ref": "#/tables/4" }, "children": [ { - "$ref": "#/texts/36" + "$ref": "#/texts/54" }, { "$ref": "#/pictures/1" }, { - "$ref": "#/texts/37" + "$ref": "#/texts/55" } ], "content_layer": "body", @@ -360,13 +486,13 @@ "label": "unspecified" }, { - "self_ref": "#/groups/15", + "self_ref": "#/groups/21", "parent": { "$ref": "#/tables/5" }, "children": [ { - "$ref": "#/groups/16" + "$ref": "#/groups/22" } ], "content_layer": "body", @@ -374,16 +500,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/16", + "self_ref": "#/groups/22", "parent": { - "$ref": "#/groups/15" + "$ref": "#/groups/21" }, "children": [ { - "$ref": "#/texts/39" + "$ref": "#/texts/57" }, { - "$ref": "#/texts/40" + "$ref": "#/texts/58" } ], "content_layer": "body", @@ -391,13 +517,13 @@ "label": "list" }, { - "self_ref": "#/groups/17", + "self_ref": "#/groups/23", "parent": { "$ref": "#/tables/5" }, "children": [ { - "$ref": "#/groups/18" + "$ref": "#/groups/24" } ], "content_layer": "body", @@ -405,16 +531,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/18", + "self_ref": "#/groups/24", "parent": { - "$ref": "#/groups/17" + "$ref": "#/groups/23" }, "children": [ { - "$ref": "#/texts/41" + "$ref": "#/texts/59" }, { - "$ref": "#/texts/42" + "$ref": "#/texts/60" } ], "content_layer": "body", @@ -422,13 +548,13 @@ "label": "list" }, { - "self_ref": "#/groups/19", + "self_ref": "#/groups/25", "parent": { "$ref": "#/tables/6" }, "children": [ { - "$ref": "#/groups/20" + "$ref": "#/groups/26" } ], "content_layer": "body", @@ -436,16 +562,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/20", + "self_ref": "#/groups/26", "parent": { - "$ref": "#/groups/19" + "$ref": "#/groups/25" }, "children": [ { - "$ref": "#/texts/44" + "$ref": "#/texts/62" }, { - "$ref": "#/texts/45" + "$ref": "#/texts/63" } ], "content_layer": "body", @@ -453,13 +579,13 @@ "label": "list" }, { - "self_ref": "#/groups/21", + "self_ref": "#/groups/27", "parent": { "$ref": "#/tables/6" }, "children": [ { - "$ref": "#/groups/22" + "$ref": "#/groups/28" } ], "content_layer": "body", @@ -467,16 +593,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/22", + "self_ref": "#/groups/28", "parent": { - "$ref": "#/groups/21" + "$ref": "#/groups/27" }, "children": [ { - "$ref": "#/texts/46" + "$ref": "#/texts/64" }, { - "$ref": "#/texts/47" + "$ref": "#/texts/65" } ], "content_layer": "body", @@ -484,13 +610,13 @@ "label": "list" }, { - "self_ref": "#/groups/23", + "self_ref": "#/groups/29", "parent": { "$ref": "#/tables/7" }, "children": [ { - "$ref": "#/groups/24" + "$ref": "#/groups/30" } ], "content_layer": "body", @@ -498,16 +624,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/24", + "self_ref": "#/groups/30", "parent": { - "$ref": "#/groups/23" + "$ref": "#/groups/29" }, "children": [ { - "$ref": "#/texts/49" + "$ref": "#/texts/67" }, { - "$ref": "#/texts/50" + "$ref": "#/texts/68" } ], "content_layer": "body", @@ -515,13 +641,13 @@ "label": "list" }, { - "self_ref": "#/groups/25", + "self_ref": "#/groups/31", "parent": { "$ref": "#/tables/7" }, "children": [ { - "$ref": "#/groups/26" + "$ref": "#/groups/32" } ], "content_layer": "body", @@ -529,16 +655,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/26", + "self_ref": "#/groups/32", "parent": { - "$ref": "#/groups/25" + "$ref": "#/groups/31" }, "children": [ { - "$ref": "#/texts/51" + "$ref": "#/texts/69" }, { - "$ref": "#/texts/52" + "$ref": "#/texts/70" } ], "content_layer": "body", @@ -546,13 +672,13 @@ "label": "list" }, { - "self_ref": "#/groups/27", + "self_ref": "#/groups/33", "parent": { "$ref": "#/tables/7" }, "children": [ { - "$ref": "#/groups/28" + "$ref": "#/groups/34" } ], "content_layer": "body", @@ -560,16 +686,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/28", + "self_ref": "#/groups/34", "parent": { - "$ref": "#/groups/27" + "$ref": "#/groups/33" }, "children": [ { - "$ref": "#/texts/53" + "$ref": "#/texts/71" }, { - "$ref": "#/texts/54" + "$ref": "#/texts/72" } ], "content_layer": "body", @@ -577,13 +703,13 @@ "label": "list" }, { - "self_ref": "#/groups/29", + "self_ref": "#/groups/35", "parent": { "$ref": "#/tables/7" }, "children": [ { - "$ref": "#/groups/30" + "$ref": "#/groups/36" } ], "content_layer": "body", @@ -591,16 +717,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/30", + "self_ref": "#/groups/36", "parent": { - "$ref": "#/groups/29" + "$ref": "#/groups/35" }, "children": [ { - "$ref": "#/texts/55" + "$ref": "#/texts/73" }, { - "$ref": "#/texts/56" + "$ref": "#/texts/74" } ], "content_layer": "body", @@ -608,13 +734,13 @@ "label": "list" }, { - "self_ref": "#/groups/31", + "self_ref": "#/groups/37", "parent": { "$ref": "#/tables/8" }, "children": [ { - "$ref": "#/groups/32" + "$ref": "#/groups/38" } ], "content_layer": "body", @@ -622,16 +748,16 @@ "label": "unspecified" }, { - "self_ref": "#/groups/32", + "self_ref": "#/groups/38", "parent": { - "$ref": "#/groups/31" + "$ref": "#/groups/37" }, "children": [ { - "$ref": "#/texts/58" + "$ref": "#/texts/76" }, { - "$ref": "#/texts/59" + "$ref": "#/texts/77" } ], "content_layer": "body", @@ -927,76 +1053,355 @@ "content_layer": "body", "label": "list_item", "prov": [], - "orig": "Number three", - "text": "Number three", - "enumerated": true, - "marker": "3." + "orig": "Number three", + "text": "Number three", + "enumerated": true, + "marker": "3." + }, + { + "self_ref": "#/texts/20", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "This is simple text with ", + "text": "This is simple text with " + }, + { + "self_ref": "#/texts/21", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "bold", + "text": "bold", + "formatting": { + "bold": true, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/22", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": ", ", + "text": ", " + }, + { + "self_ref": "#/texts/23", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "strikethrough", + "text": "strikethrough", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": true, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/24", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": " and ", + "text": " and " + }, + { + "self_ref": "#/texts/25", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "italic", + "text": "italic", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/26", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": " formatting with x", + "text": " formatting with x" + }, + { + "self_ref": "#/texts/27", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "super" + } + }, + { + "self_ref": "#/texts/28", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": " and H", + "text": " and H" + }, + { + "self_ref": "#/texts/29", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "2", + "text": "2", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "sub" + } + }, + { + "self_ref": "#/texts/30", + "parent": { + "$ref": "#/groups/10" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "O", + "text": "O" + }, + { + "self_ref": "#/texts/31", + "parent": { + "$ref": "#/groups/11" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "This is a paragraph", + "text": "This is a paragraph" + }, + { + "self_ref": "#/texts/32", + "parent": { + "$ref": "#/groups/11" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "This is another paragraph", + "text": "This is another paragraph" + }, + { + "self_ref": "#/texts/33", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "section_header", + "prov": [], + "orig": "Table with nested table", + "text": "Table with nested table", + "level": 2 + }, + { + "self_ref": "#/texts/34", + "parent": { + "$ref": "#/body" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Before table", + "text": "Before table" + }, + { + "self_ref": "#/texts/35", + "parent": { + "$ref": "#/groups/13" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "Simple cell with ", + "text": "Simple cell with " + }, + { + "self_ref": "#/texts/36", + "parent": { + "$ref": "#/groups/13" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": "bold", + "text": "bold", + "formatting": { + "bold": true, + "italic": false, + "underline": false, + "strikethrough": false, + "script": "baseline" + } + }, + { + "self_ref": "#/texts/37", + "parent": { + "$ref": "#/groups/13" + }, + "children": [], + "content_layer": "body", + "label": "text", + "prov": [], + "orig": " and ", + "text": " and " }, { - "self_ref": "#/texts/20", + "self_ref": "#/texts/38", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "This is a paragraph", - "text": "This is a paragraph" + "orig": "italic", + "text": "italic", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } }, { - "self_ref": "#/texts/21", + "self_ref": "#/texts/39", "parent": { - "$ref": "#/groups/9" + "$ref": "#/groups/13" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "This is another paragraph", - "text": "This is another paragraph" + "orig": " text", + "text": " text" }, { - "self_ref": "#/texts/22", + "self_ref": "#/texts/40", "parent": { - "$ref": "#/body" + "$ref": "#/groups/15" }, "children": [], "content_layer": "body", - "label": "section_header", + "label": "text", "prov": [], - "orig": "Table with nested table", - "text": "Table with nested table", - "level": 2 + "orig": "Cell 1", + "text": "Cell 1", + "formatting": { + "bold": false, + "italic": true, + "underline": false, + "strikethrough": false, + "script": "baseline" + } }, { - "self_ref": "#/texts/23", + "self_ref": "#/texts/41", "parent": { - "$ref": "#/body" + "$ref": "#/groups/16" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Before table", - "text": "Before table" + "orig": "Rich cell\nA nested table", + "text": "Rich cell\nA nested table" }, { - "self_ref": "#/texts/24", + "self_ref": "#/texts/42", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/17" }, "children": [], "content_layer": "body", "label": "text", "prov": [], - "orig": "Rich cell\nA nested table", - "text": "Rich cell\nA nested table" + "orig": "Cell 1", + "text": "Cell 1", + "formatting": { + "bold": false, + "italic": false, + "underline": false, + "strikethrough": true, + "script": "baseline" + } }, { - "self_ref": "#/texts/25", + "self_ref": "#/texts/43", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1006,9 +1411,9 @@ "text": "After table with " }, { - "self_ref": "#/texts/26", + "self_ref": "#/texts/44", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1025,9 +1430,9 @@ } }, { - "self_ref": "#/texts/27", + "self_ref": "#/texts/45", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1037,9 +1442,9 @@ "text": ", " }, { - "self_ref": "#/texts/28", + "self_ref": "#/texts/46", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1056,9 +1461,9 @@ } }, { - "self_ref": "#/texts/29", + "self_ref": "#/texts/47", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1068,9 +1473,9 @@ "text": ", " }, { - "self_ref": "#/texts/30", + "self_ref": "#/texts/48", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1087,9 +1492,9 @@ } }, { - "self_ref": "#/texts/31", + "self_ref": "#/texts/49", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1099,9 +1504,9 @@ "text": ", and " }, { - "self_ref": "#/texts/32", + "self_ref": "#/texts/50", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1118,9 +1523,9 @@ } }, { - "self_ref": "#/texts/33", + "self_ref": "#/texts/51", "parent": { - "$ref": "#/groups/12" + "$ref": "#/groups/18" }, "children": [], "content_layer": "body", @@ -1130,7 +1535,7 @@ "text": " formatting" }, { - "self_ref": "#/texts/34", + "self_ref": "#/texts/52", "parent": { "$ref": "#/body" }, @@ -1143,9 +1548,9 @@ "level": 2 }, { - "self_ref": "#/texts/35", + "self_ref": "#/texts/53", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/19" }, "children": [], "content_layer": "body", @@ -1155,9 +1560,9 @@ "text": "Owner avatar" }, { - "self_ref": "#/texts/36", + "self_ref": "#/texts/54", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1167,9 +1572,9 @@ "text": "Text and picture" }, { - "self_ref": "#/texts/37", + "self_ref": "#/texts/55", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1179,7 +1584,7 @@ "text": "Owner avatar" }, { - "self_ref": "#/texts/38", + "self_ref": "#/texts/56", "parent": { "$ref": "#/body" }, @@ -1192,9 +1597,9 @@ "level": 2 }, { - "self_ref": "#/texts/39", + "self_ref": "#/texts/57", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -1206,9 +1611,9 @@ "marker": "" }, { - "self_ref": "#/texts/40", + "self_ref": "#/texts/58", "parent": { - "$ref": "#/groups/16" + "$ref": "#/groups/22" }, "children": [], "content_layer": "body", @@ -1220,9 +1625,9 @@ "marker": "" }, { - "self_ref": "#/texts/41", + "self_ref": "#/texts/59", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -1234,9 +1639,9 @@ "marker": "" }, { - "self_ref": "#/texts/42", + "self_ref": "#/texts/60", "parent": { - "$ref": "#/groups/18" + "$ref": "#/groups/24" }, "children": [], "content_layer": "body", @@ -1248,7 +1653,7 @@ "marker": "" }, { - "self_ref": "#/texts/43", + "self_ref": "#/texts/61", "parent": { "$ref": "#/body" }, @@ -1261,9 +1666,9 @@ "level": 2 }, { - "self_ref": "#/texts/44", + "self_ref": "#/texts/62", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/26" }, "children": [], "content_layer": "body", @@ -1275,9 +1680,9 @@ "marker": "" }, { - "self_ref": "#/texts/45", + "self_ref": "#/texts/63", "parent": { - "$ref": "#/groups/20" + "$ref": "#/groups/26" }, "children": [], "content_layer": "body", @@ -1289,9 +1694,9 @@ "marker": "" }, { - "self_ref": "#/texts/46", + "self_ref": "#/texts/64", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/28" }, "children": [], "content_layer": "body", @@ -1303,9 +1708,9 @@ "marker": "" }, { - "self_ref": "#/texts/47", + "self_ref": "#/texts/65", "parent": { - "$ref": "#/groups/22" + "$ref": "#/groups/28" }, "children": [], "content_layer": "body", @@ -1317,7 +1722,7 @@ "marker": "" }, { - "self_ref": "#/texts/48", + "self_ref": "#/texts/66", "parent": { "$ref": "#/body" }, @@ -1330,9 +1735,9 @@ "level": 2 }, { - "self_ref": "#/texts/49", + "self_ref": "#/texts/67", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/30" }, "children": [], "content_layer": "body", @@ -1344,9 +1749,9 @@ "marker": "" }, { - "self_ref": "#/texts/50", + "self_ref": "#/texts/68", "parent": { - "$ref": "#/groups/24" + "$ref": "#/groups/30" }, "children": [], "content_layer": "body", @@ -1358,9 +1763,9 @@ "marker": "" }, { - "self_ref": "#/texts/51", + "self_ref": "#/texts/69", "parent": { - "$ref": "#/groups/26" + "$ref": "#/groups/32" }, "children": [], "content_layer": "body", @@ -1372,9 +1777,9 @@ "marker": "" }, { - "self_ref": "#/texts/52", + "self_ref": "#/texts/70", "parent": { - "$ref": "#/groups/26" + "$ref": "#/groups/32" }, "children": [], "content_layer": "body", @@ -1386,9 +1791,9 @@ "marker": "" }, { - "self_ref": "#/texts/53", + "self_ref": "#/texts/71", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/34" }, "children": [], "content_layer": "body", @@ -1400,9 +1805,9 @@ "marker": "" }, { - "self_ref": "#/texts/54", + "self_ref": "#/texts/72", "parent": { - "$ref": "#/groups/28" + "$ref": "#/groups/34" }, "children": [], "content_layer": "body", @@ -1414,9 +1819,9 @@ "marker": "" }, { - "self_ref": "#/texts/55", + "self_ref": "#/texts/73", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/36" }, "children": [], "content_layer": "body", @@ -1428,9 +1833,9 @@ "marker": "" }, { - "self_ref": "#/texts/56", + "self_ref": "#/texts/74", "parent": { - "$ref": "#/groups/30" + "$ref": "#/groups/36" }, "children": [], "content_layer": "body", @@ -1442,7 +1847,7 @@ "marker": "" }, { - "self_ref": "#/texts/57", + "self_ref": "#/texts/75", "parent": { "$ref": "#/body" }, @@ -1455,9 +1860,9 @@ "level": 2 }, { - "self_ref": "#/texts/58", + "self_ref": "#/texts/76", "parent": { - "$ref": "#/groups/32" + "$ref": "#/groups/38" }, "children": [], "content_layer": "body", @@ -1469,9 +1874,9 @@ "marker": "" }, { - "self_ref": "#/texts/59", + "self_ref": "#/texts/77", "parent": { - "$ref": "#/groups/32" + "$ref": "#/groups/38" }, "children": [], "content_layer": "body", @@ -1487,7 +1892,7 @@ { "self_ref": "#/pictures/0", "parent": { - "$ref": "#/groups/13" + "$ref": "#/groups/19" }, "children": [], "content_layer": "body", @@ -1503,14 +1908,14 @@ "width": 48.0, "height": 48.0 }, - "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAASnElEQVRogcVZCXhU1b3/3Tt3lsxM9t2QZbIACWSDhLCIbBVKsCagEuhLVCggtIBFRJEPHhaf2KqotOQVRFoofNJSIRFBFiUQkCYIJLIIJqlhmpB9zyRhMtv/fefczCQBntqW973/952cyT33nPv77/9zjgIPmAwGw0N6vV7T2dnZ86DXvh8JD2qh6Ojo8A8//HBPamrqJIfDYX/jjTf+s7q6um7UqFHJgYGBgTU1NTV5eXmHCgoKvnA4HA/qs/8+RUdHh65du3ZVTU2NsaqqijZu3EglJSXEyGazUXd3Nw0ki8XSU1xcfGbDhg1rYmNjDf8voEVRxBNPPJFeUFBwlOFkwLq6uigiIoIiApSUlJRE2dnZ5ObmRgBo6NChlJubS3a7ne4i+/nz509lZ2c/IUnSA7OG76SnnnrqsfLy8msuBHY7nT9/nubPn09pQ7V04b04DvqZR/3o74emU/vH42j9XH/+TKvVUlpaGr388stUVFQ0iBOj0VjGGPk/Ax4UFOSbn5//ofODTOJbt26lyMhIDo61R5M9iM7NpHVP+pHt9I/I8kkKLZjqRSpJcL0zsMXExPA1TCaTi5Hjx4/nDRkyJPCBgp82bdqE1tbWhj4bpi1btpCHh8cgMMNCVPT8T3yp9c+JRMfHEn0+UW6fPUx0PI1MB+Kp8HUDrX/Kn0aEqgfN9fT05IxYrVbORGdnZ2tGRsaMBwJ+6dKlOVar1cwWLi8vp+Tk5EEfnxKvo9P/FUl06hGiLzOJruUQXX+aqDSL6Otn+ht79tU8ovMzOUNfvGGg2WPdB62VmppKlZWVTmXY1q1bt/L78Cm+a/CFF15Y8tvf/vYPoihK+fn5mD59Oqqrq/mYp1bEruUh2LIoFBHh3oDDBnj4Ao1VQKMRIALUWqC1Hmi+DUgqwE0PaHSApx/Cwv2RNVaDnySpcbHiDurbbaitrcWuXbuQmJiIoUOHitOmTZsJoKuwsLDon2Zg/vz5mdu3b98jCIK4f/9+9j8sFgsfS4xQo/D1SEwcoQPIAVh7AbsV6GwBLHf6F2mtA+6YALsdEAWgqRpoa+hnxN0HDwXq8ex4CbXNvSi9ZebfOHDgAGMAI0eOxOTJk39UV1dXefny5as/mIFRo0aNOHLkyAlJklRMIgsWLIAz+WSMccexjRHw85Duncik7iTG0MD/e+8ADjsgKYHuTpm5nk7AMwCSbyAyRgI6yY7PrnTzbx06dAhDhgxhWIT09PTHTp8+fbyqqqr27k/eE3t1Op2mtLT0UkxMzIgzZ84wB3aBnxqvw/GNEVA+qJDt7gN4+gOiQjax2gr8clsFth5p5cOSJIFhmDBhAm7fvl2ZkJCQ2NbW1jVwCfHuNd9+++3XGfiamho8+eSTLvAjQtXIXxf24MAzMrUCt8uAqhuAqQUIicGWpQZMidfyYZvNhjlz5qC+vp5pI/J3v/vdu3cvMQjNsGHDIq5fv17GTGfWrFn49NNPZS4FoOSdKCRGaAZPfZC5080d8A7iJvbtxSsYvqwMtr6Safbs2dykADhSUlISLl++/LVz2iANbNq06VUG/uTJky7wjJZN90ZiiAqwOgAbAXbWHHJzkNxoYPsXGGDOXlsBdDQhKi4cS2b4uIby8vJQWFjI8b711ltvD5zmkmFkZGRIWVlZJWMgLS0NX375JX+uUgCV70UixFspvy30Sd45UxDu/T3wf9yt5wHvE8HBNXyXKt19UFnZjOglN1xx4OGHH8a5c+f477FjxyZduHDhCgZqYOXKlSuc0neCZzQvzR0hOlGWPmsWO3YXtCFhTSXcnylD8JJy/Pz9OrR32ACrve8dR//7zsbsoU9z31Sb8eNfGeE29wZUT3yNuOUVOHC+o19zplZEBmsweYQWOrXATfiLL75wagHLly9f7sQnyoISkJ2dncN+79ixgw9oVbJUskbrBgFZs78Jr57UYEbWSvgGhaG+w47ff96OCa/+Q2ZiIHiLfTATFgeu37qDieurEDtpEaZNT+dWePN2L7LeqsZ7nzT3m6WlFzOS9ejpJSQZZN9zYps9e/aTKpWqP46npqbGs9zd09NDarVcp8QHK3nf/U4Y0bYIotwIuvzKQ/yZs5IsLi4eVAosm+xB9EEU0a5ouf0hmuiPMUS7+9qeGBoXraFly5a5irfAwEDXfEkBqt8RQ/Tn4UR/iaWCjWH8ec4jnrzXaDRkNvOqhlh95tLAlClTprCeqai3txdKEQh2FxGgF8EDWp8ED16SQ7CznHD2TvqIjd9tOsys+rTSabLhwrdmVFZW8vebm5thMplc82124Phlk2uuwUcWcqi3AkoFYDabXX4wefLkyS4GUlJSxrD+7NmzfHBkkIQeC8FPK/bbtMWBhg47/Pz8eFmRnJyMefPmDWKgqcv5rn2Q2Th/t3XYuHWcOHEC4eHhiIqKQk9P/9bZ398fLdyXZMa9lPLz3l4H4oeo+e/Tp087rWaMi4Hhw4cPZ/2VK9yxMdxXgsAjIg2SZqSXCBah7HY7vvrqK94PpAhvxX004HA590NaAZo+y62qqkJnZ+eg+WztoX79a9gtciIQCRgeJHNTUlKCgZg5A+Hh4WGsr6io4IPhHiK8VEBDV//HHRYHNAJ/lxdadxNL+8vSZIe/1WBFzr5mjHyzDvFv1WHx/hbUtlihtBMWjNFBqVTeM3/q1KlQSiLM5n7NNbVa+ZinWkC4t8x5WVkZ70NCQsIVCgUktpiHhwfPGixlM/JTCQhzF/HJHUK7yQ4vjcBj9RMxKmQc3IWnf7EB7e3t3OTYIlqtFiGma1iVJuJMxR2s+NyEd17PwZ7ps0C2HhzJ34cfbS7A7kwvvPljTzTbFej0ikNbWxvUajWvt1paWnD79AdIH+srm50gRydGQzxEtHTL2qirq3MKTO3p6akT9Hq90mQy8TqZbdaZ2eRO1UIlCVh8shv7H9NjXqzalYBYKP/kWwv+1qqDMiAK5rZ6jNE1ImuEBleabMj+1ITPto5GUDADUgGw2kkXg39UVeKx5RU4/JQ3wr0U+Mu1O6igUKh0HqCmv2NmlANJD6kGJcuVH7dj15ddOLEkANfqrfj5wTYO3mq1co0HBwf7STZWMfURyweMAYeNEOcjwl8j4I9XzZgX1Z+FFQKQGSEh02ABhJtAOJupQsltC54+ZsKBVf54Z88NvP4f3lCqRUApwNJ5E9v2t2LnumDMfq0WB+Z4YX6cGhCamOsDkQywJJtO33dsRDh0rQdpoSpIDgLZ7j1LYrs2icVVs9ncodFoPPV6PXes7l4HRLuI2ZES3r9hxd9uWzE+SDG4NBAElLfbcfBbKy412FBjJuQv9EKA6EBDvQVCuxVQyQwoFALqblsw3EvAnnVBmPt2I4ZrBSQFSpg3QoMIL0V/idHX9l0xo6bTgdXj1TyLd92RGXBzc+PSZzuOtrY2k9hnV9z4AwPlw4DevtT/ZLgEvQSsLOyBrXdwZLljtiM9zwTJasPq0UoUZ7sjekgsPPwSsGdJKiQpHBBCATEcCikK+156BF6+KUg0ROHym8FYnOGBHpMVj+5tk6ONtT/0dvfYsf6UCWEeIsYESryAbDLJES8oKIj3ra2tjRaLxcFZKS8vLzMYDMNiYmJ4JKo1OaDtK0zWxiuxvtSK57+4g9xxapd9ig5ZwMZWB1RWC+602DCk4jI03r6QfB+C5OENQa0Bi8dk7YG9uwHWjnr0tHeist6KrxvsXMJ6Zp0DTIfJeeERE8eQ+6gOCrtc7TZ3yQwMGzYMTszcmdmf0tLS0hkzZjyelJTEy+jiJgfeTCTc6CVM8xdQYRDx39/YeG7YmqqCQgSYW5+b6YbNVy14syEA+m49uluboOutgZ+6Bh6SAEmUq2sm4E4rodkqwKz1hadvGA+lkfgaZ+foIPYxwCr1xQU9OFBmwS8S1Ej2VXBL8NeJuNIgu+qoUaOc+aDUxUBhYWHh2rVrWXrG5s2bcaWdYLM4ECwBdWbgOYOC791zy2y42GRHbqoSKT4ifEUgM0REScBQ5OTkOB0L3d3dvLHUz8IsC5U6nQ4ajUZOjgC++eYbNB7+Gjomc6uA03U2rDpvxpUWB56LUyI7RsnBs3LeUxDwVaOsARZynZid7sjiuKqtra3d4XC4eXt78w/vTBSxMFzEdROhxy6rt6DJgd+UO9BpA8b5Cmi1AO5KIGzybHYE49oEsSTJALOa5+jRozzssTKBqZ9pOTc3F+fPn+fMDNEK8HcTUNrigK8aeCVRhQlBksuZ43wU+KjSip+dMfN8w3KHJEn2wMBA3+bm5g6ugZ6eHsuxY8c+zsjImMe2kgcPHsTvbzmwKASI1QDXTICFCFO8gS/9BJxqFzBzqg/Ghqpw5KIJH549i+3bt3OQDBhrRqORM5Gens435Z6enrh58yZ/T2wtQdUHQxHkJeF4iQlbPm6G0NKDpcOUmOAnynsHQUCEuwAPImy/Lh/nZGZmQqVSsQR6ioHHwA3Nzp07d7J+8eLFso11AgVNxOsQ7lkO4GCtAxfMClzYHIENP/aC0GvHqlQ3XlWyumj37t28UGOMvPjii3j33Xe51A8fPozXXnuNJ8ozpwvw4c8CEKgkSA4HHhvtjtOvGbDn+RBsLbfhY6NNdgabA+4gnKmx4mKzHEIXLVrE+927d//RlbsGJoaSkpKi5OTksWPGjMHFixeR5A4cTRFQZRZQZybMv0Io3BSBNJYTOq1oa+zFhPeb8E0bcbNj0kFfmc3K3qKiIs4cq2AnTpyIhIQExI+IxcqH9Xg8QYtJ7GBMrZD3rSoRF429eGRdJXKTFIjzFOGpEpBTbMXlNsL48eO5Zqurq7+Njo4eZrFYBleSjDIyMqazzcJnn33m2mS8ZAAVjRNpbhAoc7Re3rC8E0bFi33ppTFu9NMYJY0dO5YuXbpEBw4coNra2rvvAKixsZEOHjxI1dXVFBISQqlBCqpe6UtHn/Yh+k0I0XthRL838A3Q89O9aKIvqGiSRK8ME104zpw5w9dauHDh/HuAD6SzZ8+eYC9mZmbKuyQBtHOkQN4S6MTzwURbQok2BhGt8qG9kzX8nX379vHj9hMnTtCGDRv4XUFOTg4/xa6pqRnEzEcffUQ6pUD+GtDtZz2IVvsQrfMn+lUQ0a9D6OqaIP7N3YkCqUUZ/Ny5c/lcZiHCXQcA95zsxMXFRV26dOmrjo4OPTtkbWxshKcE9BDQuXkIND1W3DSasepUF5REMHrHsTzCfYft5mJjY7nTjh49mpe+LKqtXr0aN27c4GbGADQ0NEAvWPFSnISrHYQPJrtBq5O4OdlUIjS/boJeAbC9TXBwMN+neHl59Y4fPz7l0qVL179TA4yee+65bMZxYWEhiaKsRm83gepX+xP90ptooZ42xyv483PnztGpU6coLy+P2tra6NatW/SnP/2JqZoWLVrEn7ErJnZf5qS6ujrXxcgbwwWiTIkoS030tJYacvSk7JO8QqHgtz+M1qxZ84vvBT6Q/vrXv+5hE3fs2EGCIN+wxHiJVPmUlsxzVJTsCXr22Wf54k1NTbR3715asmQJZWVl0eHDh11g8/PzuUkxYjcxmzZt4hv5hIQEGaQA2hoLopkiGaeJNFTff0iwfft2Pu/YsWOH7jad7yV2bHH8+PFDbAEmUacmPCTQBG9wx2WnGPcjp7Tr6+u59I8cOUIvvPACBz5u3DhaunQp7weeaGQEgDylfskzgTBiPqnVatX/HPo+0mg0ypMnT+Y7JanX6+Ujl/h4amlpuS/4gZIPDQ0ld3d3CgsLo/T0dHrxxRf5NezmzZvJ39//vvdm7OqKMcyoqKioQK/Xu30Xxu/VC1Pd/v37d2VlZS1kuY41VjK0trbyGxUW59kegv3PnJOVDywLszKBnTqwssLLy4vXQyxPsFqebUX37Nlzz7eY87PLlNDQULz//vvvrVixYo3FYrHdF9gPJSYBo9FYzhyVHSyxm0WmAV9f33ukx3zF29ubAgICeLyPioritj5x4kR6/PHHacGCBfz+mJnIwHlsLWbvzPTYBd/ChQuz/i3QA2n9+vWrmTqZWplzOu2e9ezy2mAw3NcUfkhjDG7bts11m8+ucdl17gMDz2jbtm1vOa8+jx49enDFihVLZs2aNYX9ttvtVnbRzcLtqlWraNSoUaRUKv9XwGxs9OjR3KFZ+O27ubcXFBR8OmnSpDH/Cr7v9QFRFAUfHx93drVjt9sH7axDQkL8s7Ozfzpnzpw5KSkp49ltJiudmV+w44+uri7uC+7u7jwhsZqo70zIUVpaeiEvLy9v7969+4xGY92/Av4HMfBDyc/PzyMtLS01Pj4+wWAwGIKCgoLc3Nx0TADd3d3dTU1NjUaj0Xj16tWrxcXFFxobG9sfxHf/Bxoc4AU61vbkAAAAAElFTkSuQmCC" + "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAScElEQVR4nM1ZCXhUVZb+36tXlUpVZd/NWlmAhM4GCWERWVxQcExAIdCTuCAEaAUbAUU+GGwcsVtE5ZOMLNINTT5pUQggyGITCEgnSEhkEUzSxnRCyL5WUlRqO/Pd+6qKBB3ttumZOd9369Zb7n1nP+eeA9xl0Ov194SFhQXgfwmEu7VRbGxs5IcffrgrPT19gt1ut73xxhv/UV9f3zhixIjUoKCgoIaGhobCwsL9RUVFX9jtdvy/gdjY2PCVK1cubWhoqK2rq6O1a9dSeXk5MbBardTX10cDwWw2G0tLS0+vWbNmRXx8vP7/BGlRFPH4449PLSoqOsLwZIj19vZSVFQURQUqKSUlhXJycsjd3Z0A0JAhQyg/P59sNtsgYojIdu7cuZM5OTmPS5J017ThR2HmzJmPVlVVXXFhYLPRuXPnaM6cOZQxREPn303gSD/1oD/9df9D1HVwDK2eFcDvaTQaysjIoJdffplKSkoGUVJbW1vJCPmXIR4cHOx34MCBD50fZBzftGkTRUdHc+TYeDDVk+jsI7TqCX+ynnqAzJ+m0TOTvUklCa53Bo64uDi+h8FgcBFy7NixwrCwsKC7ivz9998/rqOjo9mhw7Rx40by9PQchMzQUBW98G9+1PGnZKJjo4n+PF4en99LdCyDDHsTqfh1Pa2eGUDDw90GrfXy8uKEWCwWTkRPT09HZmbmlLuC/MKFC3MtFouJbVxVVUWpqamDPj4pUUun/jOa6OR9RF9mEV3JJbr6JFFFNtHXT90e7N5Xs4nOPcIJ+uINPU0f7TFor/T0dKqpqXEKw7pq1aol/xTyL774Yp5zt8LCQq7DLq5pRCpYGkb0aQrRibFEx0fLSDOOH0wkOjWJ6NIviYofIDqaTnQ+czBBF2cSnRhDZRtjKFWvdu2r0+no8OHDLpVau3btsh/D8X+0/Dlz5mQVFBR8IoqiYs+ePcjNzYXNZuPPkqPccHBVJCIDVQN2EgBBBOzyO3DTAJZ+x7UAePoCRgNABNwTA6i18n9DB/ob6/Cr/Dr8/mQXXypJEnbv3o3Zs2ezS/uCBQue2rZtW8HfTcCIESOGl5SUXFCpVO47duxAXl4enMEnc5QH9iwPh7tKxM8CpZtMqM0KqNRAYCTzy0BDNTZ8VIeXdjU7+CFg+/btePbZZxnjzJMmTRp39uzZsp8kQKvVqisqKsri4uKGnz59mhmwC/nJiVocWxsF5d1y2R6+gFcAICoASQXcrMavN1dj0+EOlyQYDuPGjcONGzdqkpKSkjs7O3sHbvE9Nr711luvM+QbGhrwxBNPuJAfHu6GA6si7h7yDAwdwI1KoO4aYGgHQuOwcaEekxI1/LHVasWMGTPQ1NSEsLCw6Pfee++dO7cYhM3QoUOjrl69WilJkmratGn47LPPZCoFoPztGCRHqQcvvZux090D8AkGJCW+vXAJwxZVwupImaZPn479+/ezv/a0tLSkixcvfv2DEli3bt2rDPkTJ064kGew6CEfJIeqAIsdsBJgY8MuDzvJgwaOn0HALQNXIXS3IiYhEnlTfF2PCgsLUVxczPHdsGHDWwOXuXgYHR0dWllZWcMIyMjIwJdffsnvqxRAzbvRCPVRym9zbzNgpfN64P+B14O+4rhwXhOBMVl0vucED1/U1LQhNu8a5weDe++9F2fPnuX/R48enXL+/PlLnCLnmiVLlix2ct+JPIPZGR4I1Yoy99kw27CzqBNJK2rg8VQlQvKq8KttjejqtgIWm+Mdx7sDB9MHh+S+qTfh4d/Uwn3WNage/xoJz1dj77nu25IzdCA6RI2JwzXQuglchb/44gunFPD8888/78RPdLqsnJycXPZ/69at/IFGJXMle6R2ECIr9rTi1RNqTMleAr/gCDR12/D+n7sw7tW/yUQMRN7sIMh1bcfV725h/Oo6xE+Yh/sfmsq18PqNfmRvqMe7n7bdVktzP6ak6mDsJ6ToZdtz4jZ9+vQnVCqV5OJyenp6Iot6RqOR3NzkPCUxRMnnvrcjiDZHEeVH0cVX7uH3nJlkaWnpoFRg0URPog9iiHbEyuP3sUR/iCPa6Ri74mhMrJoWLVrkirRBQUGu9ZIC1LQ1juhPw4g+iqeitRH8fu59XnxWq9VkMvGshlh+5pLApEmTJrGZiai/vx9KEQjxEBGoE8EdmoOD+8pkF1xfXz9odsIn7PmdqsPUyiGVHoMV5781oaamhr/f1tYGg8HgWm+1AccuGlxr9b4yk8N9FFAqAJPJ5LKDiRMnTnQRkJaWNorNZ86c4Q9/ESzBaCb4axy6zxAw29HcbYO/vz9LM5CamuoM9S5o7XW+O0B1BqhUZ7eVa8fx48cRGRmJmJgYGI1G1/qAgAC0c1uSCfdWyvf7++1IDHPj/0+dOuXUmlEuAoYNGzaMzZcuccPGMD8JLIMn5gIGcDPaWwTzUCwn+uqrr1y5kROifBQ/IAGHFCx23KMRoHZobl1dHXp6egatZ3sP8b+9h40Rz5AkYFiwTE15eTkG4swJiIyMjGBzdXU1fxjpKcJbBTT33v643WyHWuDvYsiQIbgTWNhflCEb/HfNFuQWtOEXbzYicUMj5u9px812C5Q2wjOjtFAqHawdAJMnT4ZSEmEy3ZZca4eFP/NyExDpI1NeWVnJ59DQ0EiFQgGJbebpyVJF8JDNwF8lIMJDxKe3CF0GG7zVzJUJeDxOhcx9O/Dkc2vQ1dXFVY5totFoEGq4gqUZIk5X38LiPxvw9uu52PXQNJDViMMHCvDA+iLszPLGmw97oc2mQI93Ajo7O+Hm5sbzrfb2dtw49QGmjvaT1U6QvRODME8R7X2yNBobG/ksSZKbl5eXVtDpdEqDwWB2HtaZ2uRP1kAlCZh/og97HtVhdrybKwAxV/7pt2b8pUMLZWAMTJ1NGKVtQfZwNS61WpHzmQGfbxqJ4BCGSDXAcidtHP5WV4NHn6/GoZk+iPRW4KMrt1BN4VBpPUGtf8UjMXak3KMaFCyXHOzCji97cTwvEFeaLPjVvk6OvMVi4RIPCQnxl6wsY3IAiweMALuVkOArIkAt4A+XTZgdczsKKwQgK0pClt4MCNeBSLZShfIbZjx51IC9SwPw9q5reP3ffaB0EwGlAHPPdWze04Htq0Iw/bWb2DvDG3MSWFrdykwfiGYIS7LqOL5jJcL+K0ZkhKsg2QnkTIwGADu1ScyvmkymbrVa7aXT6bhh9fXbIdpETI+WsO2aBX+5YcHYYMXg1EAQUNVlw75vLShrtqLBRDgw1xuBoh3NTWYIXRaAnRmUAhQKAY03zBjmLWDXqmDMeqsFwzQCUoIkzB6uRpS34naK4RgFl0xo6LFj2Vg3HsV7b8kEuLu7c+4DsHV2dhq4ETc2NnLlDwqSiwH9jtD/RKQEnQQsKTbC2j/Ys9wy2TC10ADJYsWykUqU5nggNiwenv5J2JWXDkmKBIRwQIyEQopBwUv3wdsvDcn6GFx8MwTzMz1hNFjw4O5O2ds40xCLHX1GG1afNCDCU8SoIIknkK0G2eMFBwfzuaOjo8VsNts5KVVVVZV6vX5oXFwc90Q3DXZoHInJykQlVldY8MIXt5A/hold5pRolxlc22GHymLGrXYrwqovQu3jB8nvHkiePhDc1GD+mCxG2PqaYelugrGrBzVNFnzdbOMc1jHtHKA6jM9zDxs4DvkPaqFgRmcntPXKBAwdOhROnLkxs5+KioqKKVOmPJaSksLT6NJWO95MJlzrJ9wfIKBaL+K/vrHy2LApXQWFCDCzPvuIO9ZfNuPN5kDo+nTo62iFtr8B/m4N8JQESKKcXTMG91gIbRYBJo0fvPwiuCuNxtc4M0ML0UEAy9TnFxmxt9KM55LckOqn4JoQoBVxqVk21REjRvC5vLy8wkVAcXFx8cqVK1l4xvr163Gpi2A12xEiAY0mYIFeAbID+ZVWXGi1IT9diTRfEX4ikBUqojxwCD/0OwwLfX19fLDQz9wsc5VarRZqtVoOjgC++eYbtBz6GlrGc4uAU41WLD1nwqV2OxYkKJETp+TIs3TeSxDwVYssAeZynTg7zZH5cVVnZ2eX3W539/Hx4R/enixibqSIqwaCkRcWBBS12vG7Kjt6rMAYPwEdZsBDCURMnM5KMK5DEAuSDGGW8xw5coS7PZYmMPEzKefn5+PcuXOcmDCNgAB3ARXtdvi5Aa8kqzAuWHIZc4KvAp/UWPDsaROPNyx2SJJkCwoK8mtra+vmEjAajeajR48ezMzMnM2Okvv27cP739kxLxSIVwNXDICZCJN8gC/9BZzsEvDIZF+MDlfh8AUDPjxzBlu2bOFIMsTYqK2t5URMnTqVH8q9vLxw/fp1/p7YUY66D4Yg2FvCsXIDNh5sg9BuxMKhSozzF+WzgyAgykOAJxG2XOVhCllZWVCpVCyAnmTI89jl9KnbWQ0DwPz582Ud6wGKWonnIdyy7MC+m3acNylwfn0U1jzsDaHfhqXp7jyrZHnRzp07eaLGCFm+fDneeecdzvVDhw7htdde44Hy9KkifPhsIIKUBMlux6MjPXDqNT12vRCKTVVWHKy1ysZgtcMDhNMNFlxok13ovHnz+Lxz584/uGLXwMBQXl5ekpqaOnrUqFG4cOECUjyAI2kC6kwCGk2EOZcIxeuikMFiQo8FnS39GLetFd90Elc7xh1nms3S3pKSEk4cy2DHjx+PpKQkJA6Px5J7dXgsSYMJw7WAm0I+t6pEXKjtx32rapCfokCClwgvlYDcUgsudhLGjh3LJVtfX/9tbGzsULOZpbx3QGZm5kPssPD555+7Dhkv6UElY0SaFQzKGqmTDyxvR1DpfD96aZQ7/TJOSaNHj6aysjLau3cv3bx5884eALW0tNC+ffuovr6eQkNDKT1YQfVL/OjIk75EvwslejeC6H09PwC98JA3jfcDlUyQ6JWhXP58nD59mu81d+7cOfgxOHPmzHH2YlZWlnxKEkDbfyGQjwQ6/kII0cZworXBREt9afdEuaZZUFDAy+3Hjx+nNWvW8F5Bbm4ur2I3NDQMIuaTTz4hrVKgADXoxtOeRMt8iVYFEP0mmOi3oXR5RTD/5s5kgdxEGflZs2bxtUxDWLozEL5X2UlISIgpKyv7qru7W5ecnIyWlhZ4SYCRgJ71YVAbLbhea8LSk71QEqHWJ4HFEW477DQXHx/PjXbkyJE89WVebdmyZbh27RpXM4ZAc3MzdIIFLyVIuNxN+GCiOzRaiauTVSVC/dtW6BQAO9uEhITwc4q3t3f/2LFj08rKyq7ip2DBggU5jOLi4mISRVmMPu4CNS0LIPq1D9FcHa1PVPD7Z8+epZMnT/LqdWdnJ3333Xf0xz/+kYma5s2bx++xFhPrlzmhsbHR1Rh5Y5hAlCURZbsRPamh5lwdKR2cVygUvPvDYMWKFc/hH4GPP/54F1u4detWEgS5wxLnLVLNTA2ZZqgo1Qv09NNP881bW1tp9+7dlJeXR9nZ2XTo0CEXsgcOHOAqxYB1YtatW8cP8klJSTKSAmhTPIgeEan2fpGG6G4XCbZs2cLXHT16dP+dqvOTwMoWx44d2882YBx1SsJTAo3zATdcVsX4IXByu6mpiXOf1ftffPFFjviYMWNo4cKFfMaAikZmIMhLus15xhAGzCY1Go18IP5HQa1WK0+cOHHAyUnWfOAll8REam9v/0HkB3I+PDycPDw8KCIigqZOnUrLly/nbdj169dTQIDc+MMdg7WunA2OkpKSIp1O5/5jOP6kXJjo9uzZsyM7O3sui3VssJSho6MDN2/e5H6enSHYNTNOlj6wKMzSBFZ1YGmFt7c3z4dYnGC5PDuK7tq163vfYsbPminh4eHYtm3bu4sXL15hNptdB66fBYwDtbW1VcxQWWGJdRaZBPz8/L7HPWYrPj4+FBgYyP19TEwM1/Xx48fTY489Rs888wzvHzMVGbjOz8+P6ztTPdbgmzt3bjbuFqxevXoZEycTKzNOp96zmTWv9Xr9D6rC3zNiYmJo8+bNrm4+a+Oydi7uJmzevHkD25xx5siRI/sWL16cN23atEnsv81ms7BGN3O3S5cupREjRpBSKZckf2iwZyNHjuQGzdyvTe7c24qKij6bMGECL1T9o/CTNiCKouDr6+vBWjs2G6u83obQ0NCAnJycX86YMWNGWlraWFEUJZY6M7tg5Y/e3l5uCx4eHjwgsZzIUROyV1RUnC8sLCzcvXt3QW1trVwr+VcQ8PeCv7+/Z0ZGRnpiYmKSXq/XBwcHB7u7u2sZA/r6+vpaW1tbamtray9fvny5tLT0fEtLi9yS/CfhvwEPv/IpB1dpMAAAAABJRU5ErkJggg==" }, "annotations": [] }, { "self_ref": "#/pictures/1", "parent": { - "$ref": "#/groups/14" + "$ref": "#/groups/20" }, "children": [], "content_layer": "body", @@ -1526,7 +1931,7 @@ "width": 48.0, "height": 48.0 }, - "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAASnElEQVRogcVZCXhU1b3/3Tt3lsxM9t2QZbIACWSDhLCIbBVKsCagEuhLVCggtIBFRJEPHhaf2KqotOQVRFoofNJSIRFBFiUQkCYIJLIIJqlhmpB9zyRhMtv/fefczCQBntqW973/952cyT33nPv77/9zjgIPmAwGw0N6vV7T2dnZ86DXvh8JD2qh6Ojo8A8//HBPamrqJIfDYX/jjTf+s7q6um7UqFHJgYGBgTU1NTV5eXmHCgoKvnA4HA/qs/8+RUdHh65du3ZVTU2NsaqqijZu3EglJSXEyGazUXd3Nw0ki8XSU1xcfGbDhg1rYmNjDf8voEVRxBNPPJFeUFBwlOFkwLq6uigiIoIiApSUlJRE2dnZ5ObmRgBo6NChlJubS3a7ne4i+/nz509lZ2c/IUnSA7OG76SnnnrqsfLy8msuBHY7nT9/nubPn09pQ7V04b04DvqZR/3o74emU/vH42j9XH/+TKvVUlpaGr388stUVFQ0iBOj0VjGGPk/Ax4UFOSbn5//ofODTOJbt26lyMhIDo61R5M9iM7NpHVP+pHt9I/I8kkKLZjqRSpJcL0zsMXExPA1TCaTi5Hjx4/nDRkyJPCBgp82bdqE1tbWhj4bpi1btpCHh8cgMMNCVPT8T3yp9c+JRMfHEn0+UW6fPUx0PI1MB+Kp8HUDrX/Kn0aEqgfN9fT05IxYrVbORGdnZ2tGRsaMBwJ+6dKlOVar1cwWLi8vp+Tk5EEfnxKvo9P/FUl06hGiLzOJruUQXX+aqDSL6Otn+ht79tU8ovMzOUNfvGGg2WPdB62VmppKlZWVTmXY1q1bt/L78Cm+a/CFF15Y8tvf/vYPoihK+fn5mD59Oqqrq/mYp1bEruUh2LIoFBHh3oDDBnj4Ao1VQKMRIALUWqC1Hmi+DUgqwE0PaHSApx/Cwv2RNVaDnySpcbHiDurbbaitrcWuXbuQmJiIoUOHitOmTZsJoKuwsLDon2Zg/vz5mdu3b98jCIK4f/9+9j8sFgsfS4xQo/D1SEwcoQPIAVh7AbsV6GwBLHf6F2mtA+6YALsdEAWgqRpoa+hnxN0HDwXq8ex4CbXNvSi9ZebfOHDgAGMAI0eOxOTJk39UV1dXefny5as/mIFRo0aNOHLkyAlJklRMIgsWLIAz+WSMccexjRHw85Duncik7iTG0MD/e+8ADjsgKYHuTpm5nk7AMwCSbyAyRgI6yY7PrnTzbx06dAhDhgxhWIT09PTHTp8+fbyqqqr27k/eE3t1Op2mtLT0UkxMzIgzZ84wB3aBnxqvw/GNEVA+qJDt7gN4+gOiQjax2gr8clsFth5p5cOSJIFhmDBhAm7fvl2ZkJCQ2NbW1jVwCfHuNd9+++3XGfiamho8+eSTLvAjQtXIXxf24MAzMrUCt8uAqhuAqQUIicGWpQZMidfyYZvNhjlz5qC+vp5pI/J3v/vdu3cvMQjNsGHDIq5fv17GTGfWrFn49NNPZS4FoOSdKCRGaAZPfZC5080d8A7iJvbtxSsYvqwMtr6Safbs2dykADhSUlISLl++/LVz2iANbNq06VUG/uTJky7wjJZN90ZiiAqwOgAbAXbWHHJzkNxoYPsXGGDOXlsBdDQhKi4cS2b4uIby8vJQWFjI8b711ltvD5zmkmFkZGRIWVlZJWMgLS0NX375JX+uUgCV70UixFspvy30Sd45UxDu/T3wf9yt5wHvE8HBNXyXKt19UFnZjOglN1xx4OGHH8a5c+f477FjxyZduHDhCgZqYOXKlSuc0neCZzQvzR0hOlGWPmsWO3YXtCFhTSXcnylD8JJy/Pz9OrR32ACrve8dR//7zsbsoU9z31Sb8eNfGeE29wZUT3yNuOUVOHC+o19zplZEBmsweYQWOrXATfiLL75wagHLly9f7sQnyoISkJ2dncN+79ixgw9oVbJUskbrBgFZs78Jr57UYEbWSvgGhaG+w47ff96OCa/+Q2ZiIHiLfTATFgeu37qDieurEDtpEaZNT+dWePN2L7LeqsZ7nzT3m6WlFzOS9ejpJSQZZN9zYps9e/aTKpWqP46npqbGs9zd09NDarVcp8QHK3nf/U4Y0bYIotwIuvzKQ/yZs5IsLi4eVAosm+xB9EEU0a5ouf0hmuiPMUS7+9qeGBoXraFly5a5irfAwEDXfEkBqt8RQ/Tn4UR/iaWCjWH8ec4jnrzXaDRkNvOqhlh95tLAlClTprCeqai3txdKEQh2FxGgF8EDWp8ED16SQ7CznHD2TvqIjd9tOsys+rTSabLhwrdmVFZW8vebm5thMplc82124Phlk2uuwUcWcqi3AkoFYDabXX4wefLkyS4GUlJSxrD+7NmzfHBkkIQeC8FPK/bbtMWBhg47/Pz8eFmRnJyMefPmDWKgqcv5rn2Q2Th/t3XYuHWcOHEC4eHhiIqKQk9P/9bZ398fLdyXZMa9lPLz3l4H4oeo+e/Tp087rWaMi4Hhw4cPZ/2VK9yxMdxXgsAjIg2SZqSXCBah7HY7vvrqK94PpAhvxX004HA590NaAZo+y62qqkJnZ+eg+WztoX79a9gtciIQCRgeJHNTUlKCgZg5A+Hh4WGsr6io4IPhHiK8VEBDV//HHRYHNAJ/lxdadxNL+8vSZIe/1WBFzr5mjHyzDvFv1WHx/hbUtlihtBMWjNFBqVTeM3/q1KlQSiLM5n7NNbVa+ZinWkC4t8x5WVkZ70NCQsIVCgUktpiHhwfPGixlM/JTCQhzF/HJHUK7yQ4vjcBj9RMxKmQc3IWnf7EB7e3t3OTYIlqtFiGma1iVJuJMxR2s+NyEd17PwZ7ps0C2HhzJ34cfbS7A7kwvvPljTzTbFej0ikNbWxvUajWvt1paWnD79AdIH+srm50gRydGQzxEtHTL2qirq3MKTO3p6akT9Hq90mQy8TqZbdaZ2eRO1UIlCVh8shv7H9NjXqzalYBYKP/kWwv+1qqDMiAK5rZ6jNE1ImuEBleabMj+1ITPto5GUDADUgGw2kkXg39UVeKx5RU4/JQ3wr0U+Mu1O6igUKh0HqCmv2NmlANJD6kGJcuVH7dj15ddOLEkANfqrfj5wTYO3mq1co0HBwf7STZWMfURyweMAYeNEOcjwl8j4I9XzZgX1Z+FFQKQGSEh02ABhJtAOJupQsltC54+ZsKBVf54Z88NvP4f3lCqRUApwNJ5E9v2t2LnumDMfq0WB+Z4YX6cGhCamOsDkQywJJtO33dsRDh0rQdpoSpIDgLZ7j1LYrs2icVVs9ncodFoPPV6PXes7l4HRLuI2ZES3r9hxd9uWzE+SDG4NBAElLfbcfBbKy412FBjJuQv9EKA6EBDvQVCuxVQyQwoFALqblsw3EvAnnVBmPt2I4ZrBSQFSpg3QoMIL0V/idHX9l0xo6bTgdXj1TyLd92RGXBzc+PSZzuOtrY2k9hnV9z4AwPlw4DevtT/ZLgEvQSsLOyBrXdwZLljtiM9zwTJasPq0UoUZ7sjekgsPPwSsGdJKiQpHBBCATEcCikK+156BF6+KUg0ROHym8FYnOGBHpMVj+5tk6ONtT/0dvfYsf6UCWEeIsYESryAbDLJES8oKIj3ra2tjRaLxcFZKS8vLzMYDMNiYmJ4JKo1OaDtK0zWxiuxvtSK57+4g9xxapd9ig5ZwMZWB1RWC+602DCk4jI03r6QfB+C5OENQa0Bi8dk7YG9uwHWjnr0tHeist6KrxvsXMJ6Zp0DTIfJeeERE8eQ+6gOCrtc7TZ3yQwMGzYMTszcmdmf0tLS0hkzZjyelJTEy+jiJgfeTCTc6CVM8xdQYRDx39/YeG7YmqqCQgSYW5+b6YbNVy14syEA+m49uluboOutgZ+6Bh6SAEmUq2sm4E4rodkqwKz1hadvGA+lkfgaZ+foIPYxwCr1xQU9OFBmwS8S1Ej2VXBL8NeJuNIgu+qoUaOc+aDUxUBhYWHh2rVrWXrG5s2bcaWdYLM4ECwBdWbgOYOC791zy2y42GRHbqoSKT4ifEUgM0REScBQ5OTkOB0L3d3dvLHUz8IsC5U6nQ4ajUZOjgC++eYbNB7+Gjomc6uA03U2rDpvxpUWB56LUyI7RsnBs3LeUxDwVaOsARZynZid7sjiuKqtra3d4XC4eXt78w/vTBSxMFzEdROhxy6rt6DJgd+UO9BpA8b5Cmi1AO5KIGzybHYE49oEsSTJALOa5+jRozzssTKBqZ9pOTc3F+fPn+fMDNEK8HcTUNrigK8aeCVRhQlBksuZ43wU+KjSip+dMfN8w3KHJEn2wMBA3+bm5g6ugZ6eHsuxY8c+zsjImMe2kgcPHsTvbzmwKASI1QDXTICFCFO8gS/9BJxqFzBzqg/Ghqpw5KIJH549i+3bt3OQDBhrRqORM5Gens435Z6enrh58yZ/T2wtQdUHQxHkJeF4iQlbPm6G0NKDpcOUmOAnynsHQUCEuwAPImy/Lh/nZGZmQqVSsQR6ioHHwA3Nzp07d7J+8eLFso11AgVNxOsQ7lkO4GCtAxfMClzYHIENP/aC0GvHqlQ3XlWyumj37t28UGOMvPjii3j33Xe51A8fPozXXnuNJ8ozpwvw4c8CEKgkSA4HHhvtjtOvGbDn+RBsLbfhY6NNdgabA+4gnKmx4mKzHEIXLVrE+927d//RlbsGJoaSkpKi5OTksWPGjMHFixeR5A4cTRFQZRZQZybMv0Io3BSBNJYTOq1oa+zFhPeb8E0bcbNj0kFfmc3K3qKiIs4cq2AnTpyIhIQExI+IxcqH9Xg8QYtJ7GBMrZD3rSoRF429eGRdJXKTFIjzFOGpEpBTbMXlNsL48eO5Zqurq7+Njo4eZrFYBleSjDIyMqazzcJnn33m2mS8ZAAVjRNpbhAoc7Re3rC8E0bFi33ppTFu9NMYJY0dO5YuXbpEBw4coNra2rvvAKixsZEOHjxI1dXVFBISQqlBCqpe6UtHn/Yh+k0I0XthRL838A3Q89O9aKIvqGiSRK8ME104zpw5w9dauHDh/HuAD6SzZ8+eYC9mZmbKuyQBtHOkQN4S6MTzwURbQok2BhGt8qG9kzX8nX379vHj9hMnTtCGDRv4XUFOTg4/xa6pqRnEzEcffUQ6pUD+GtDtZz2IVvsQrfMn+lUQ0a9D6OqaIP7N3YkCqUUZ/Ny5c/lcZiHCXQcA95zsxMXFRV26dOmrjo4OPTtkbWxshKcE9BDQuXkIND1W3DSasepUF5REMHrHsTzCfYft5mJjY7nTjh49mpe+LKqtXr0aN27c4GbGADQ0NEAvWPFSnISrHYQPJrtBq5O4OdlUIjS/boJeAbC9TXBwMN+neHl59Y4fPz7l0qVL179TA4yee+65bMZxYWEhiaKsRm83gepX+xP90ptooZ42xyv483PnztGpU6coLy+P2tra6NatW/SnP/2JqZoWLVrEn7ErJnZf5qS6ujrXxcgbwwWiTIkoS030tJYacvSk7JO8QqHgtz+M1qxZ84vvBT6Q/vrXv+5hE3fs2EGCIN+wxHiJVPmUlsxzVJTsCXr22Wf54k1NTbR3715asmQJZWVl0eHDh11g8/PzuUkxYjcxmzZt4hv5hIQEGaQA2hoLopkiGaeJNFTff0iwfft2Pu/YsWOH7jad7yV2bHH8+PFDbAEmUacmPCTQBG9wx2WnGPcjp7Tr6+u59I8cOUIvvPACBz5u3DhaunQp7weeaGQEgDylfskzgTBiPqnVatX/HPo+0mg0ypMnT+Y7JanX6+Ujl/h4amlpuS/4gZIPDQ0ld3d3CgsLo/T0dHrxxRf5NezmzZvJ39//vvdm7OqKMcyoqKioQK/Xu30Xxu/VC1Pd/v37d2VlZS1kuY41VjK0trbyGxUW59kegv3PnJOVDywLszKBnTqwssLLy4vXQyxPsFqebUX37Nlzz7eY87PLlNDQULz//vvvrVixYo3FYrHdF9gPJSYBo9FYzhyVHSyxm0WmAV9f33ukx3zF29ubAgICeLyPioritj5x4kR6/PHHacGCBfz+mJnIwHlsLWbvzPTYBd/ChQuz/i3QA2n9+vWrmTqZWplzOu2e9ezy2mAw3NcUfkhjDG7bts11m8+ucdl17gMDz2jbtm1vOa8+jx49enDFihVLZs2aNYX9ttvtVnbRzcLtqlWraNSoUaRUKv9XwGxs9OjR3KFZ+O27ubcXFBR8OmnSpDH/Cr7v9QFRFAUfHx93drVjt9sH7axDQkL8s7Ozfzpnzpw5KSkp49ltJiudmV+w44+uri7uC+7u7jwhsZqo70zIUVpaeiEvLy9v7969+4xGY92/Av4HMfBDyc/PzyMtLS01Pj4+wWAwGIKCgoLc3Nx0TADd3d3dTU1NjUaj0Xj16tWrxcXFFxobG9sfxHf/Bxoc4AU61vbkAAAAAElFTkSuQmCC" + "uri": "data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAADAAAAAwCAYAAABXAvmHAAAScElEQVR4nM1ZCXhUVZb+36tXlUpVZd/NWlmAhM4GCWERWVxQcExAIdCTuCAEaAUbAUU+GGwcsVtE5ZOMLNINTT5pUQggyGITCEgnSEhkEUzSxnRCyL5WUlRqO/Pd+6qKBB3ttumZOd9369Zb7n1nP+eeA9xl0Ov194SFhQXgfwmEu7VRbGxs5IcffrgrPT19gt1ut73xxhv/UV9f3zhixIjUoKCgoIaGhobCwsL9RUVFX9jtdvy/gdjY2PCVK1cubWhoqK2rq6O1a9dSeXk5MbBardTX10cDwWw2G0tLS0+vWbNmRXx8vP7/BGlRFPH4449PLSoqOsLwZIj19vZSVFQURQUqKSUlhXJycsjd3Z0A0JAhQyg/P59sNtsgYojIdu7cuZM5OTmPS5J017ThR2HmzJmPVlVVXXFhYLPRuXPnaM6cOZQxREPn303gSD/1oD/9df9D1HVwDK2eFcDvaTQaysjIoJdffplKSkoGUVJbW1vJCPmXIR4cHOx34MCBD50fZBzftGkTRUdHc+TYeDDVk+jsI7TqCX+ynnqAzJ+m0TOTvUklCa53Bo64uDi+h8FgcBFy7NixwrCwsKC7ivz9998/rqOjo9mhw7Rx40by9PQchMzQUBW98G9+1PGnZKJjo4n+PF4en99LdCyDDHsTqfh1Pa2eGUDDw90GrfXy8uKEWCwWTkRPT09HZmbmlLuC/MKFC3MtFouJbVxVVUWpqamDPj4pUUun/jOa6OR9RF9mEV3JJbr6JFFFNtHXT90e7N5Xs4nOPcIJ+uINPU0f7TFor/T0dKqpqXEKw7pq1aol/xTyL774Yp5zt8LCQq7DLq5pRCpYGkb0aQrRibFEx0fLSDOOH0wkOjWJ6NIviYofIDqaTnQ+czBBF2cSnRhDZRtjKFWvdu2r0+no8OHDLpVau3btsh/D8X+0/Dlz5mQVFBR8IoqiYs+ePcjNzYXNZuPPkqPccHBVJCIDVQN2EgBBBOzyO3DTAJZ+x7UAePoCRgNABNwTA6i18n9DB/ob6/Cr/Dr8/mQXXypJEnbv3o3Zs2ezS/uCBQue2rZtW8HfTcCIESOGl5SUXFCpVO47duxAXl4enMEnc5QH9iwPh7tKxM8CpZtMqM0KqNRAYCTzy0BDNTZ8VIeXdjU7+CFg+/btePbZZxnjzJMmTRp39uzZsp8kQKvVqisqKsri4uKGnz59mhmwC/nJiVocWxsF5d1y2R6+gFcAICoASQXcrMavN1dj0+EOlyQYDuPGjcONGzdqkpKSkjs7O3sHbvE9Nr711luvM+QbGhrwxBNPuJAfHu6GA6si7h7yDAwdwI1KoO4aYGgHQuOwcaEekxI1/LHVasWMGTPQ1NSEsLCw6Pfee++dO7cYhM3QoUOjrl69WilJkmratGn47LPPZCoFoPztGCRHqQcvvZux090D8AkGJCW+vXAJwxZVwupImaZPn479+/ezv/a0tLSkixcvfv2DEli3bt2rDPkTJ064kGew6CEfJIeqAIsdsBJgY8MuDzvJgwaOn0HALQNXIXS3IiYhEnlTfF2PCgsLUVxczPHdsGHDWwOXuXgYHR0dWllZWcMIyMjIwJdffsnvqxRAzbvRCPVRym9zbzNgpfN64P+B14O+4rhwXhOBMVl0vucED1/U1LQhNu8a5weDe++9F2fPnuX/R48enXL+/PlLnCLnmiVLlix2ct+JPIPZGR4I1Yoy99kw27CzqBNJK2rg8VQlQvKq8KttjejqtgIWm+Mdx7sDB9MHh+S+qTfh4d/Uwn3WNage/xoJz1dj77nu25IzdCA6RI2JwzXQuglchb/44gunFPD8888/78RPdLqsnJycXPZ/69at/IFGJXMle6R2ECIr9rTi1RNqTMleAr/gCDR12/D+n7sw7tW/yUQMRN7sIMh1bcfV725h/Oo6xE+Yh/sfmsq18PqNfmRvqMe7n7bdVktzP6ak6mDsJ6ToZdtz4jZ9+vQnVCqV5OJyenp6Iot6RqOR3NzkPCUxRMnnvrcjiDZHEeVH0cVX7uH3nJlkaWnpoFRg0URPog9iiHbEyuP3sUR/iCPa6Ri74mhMrJoWLVrkirRBQUGu9ZIC1LQ1juhPw4g+iqeitRH8fu59XnxWq9VkMvGshlh+5pLApEmTJrGZiai/vx9KEQjxEBGoE8EdmoOD+8pkF1xfXz9odsIn7PmdqsPUyiGVHoMV5781oaamhr/f1tYGg8HgWm+1AccuGlxr9b4yk8N9FFAqAJPJ5LKDiRMnTnQRkJaWNorNZ86c4Q9/ESzBaCb4axy6zxAw29HcbYO/vz9LM5CamuoM9S5o7XW+O0B1BqhUZ7eVa8fx48cRGRmJmJgYGI1G1/qAgAC0c1uSCfdWyvf7++1IDHPj/0+dOuXUmlEuAoYNGzaMzZcuccPGMD8JLIMn5gIGcDPaWwTzUCwn+uqrr1y5kROifBQ/IAGHFCx23KMRoHZobl1dHXp6egatZ3sP8b+9h40Rz5AkYFiwTE15eTkG4swJiIyMjGBzdXU1fxjpKcJbBTT33v643WyHWuDvYsiQIbgTWNhflCEb/HfNFuQWtOEXbzYicUMj5u9px812C5Q2wjOjtFAqHawdAJMnT4ZSEmEy3ZZca4eFP/NyExDpI1NeWVnJ59DQ0EiFQgGJbebpyVJF8JDNwF8lIMJDxKe3CF0GG7zVzJUJeDxOhcx9O/Dkc2vQ1dXFVY5totFoEGq4gqUZIk5X38LiPxvw9uu52PXQNJDViMMHCvDA+iLszPLGmw97oc2mQI93Ajo7O+Hm5sbzrfb2dtw49QGmjvaT1U6QvRODME8R7X2yNBobG/ksSZKbl5eXVtDpdEqDwWB2HtaZ2uRP1kAlCZh/og97HtVhdrybKwAxV/7pt2b8pUMLZWAMTJ1NGKVtQfZwNS61WpHzmQGfbxqJ4BCGSDXAcidtHP5WV4NHn6/GoZk+iPRW4KMrt1BN4VBpPUGtf8UjMXak3KMaFCyXHOzCji97cTwvEFeaLPjVvk6OvMVi4RIPCQnxl6wsY3IAiweMALuVkOArIkAt4A+XTZgdczsKKwQgK0pClt4MCNeBSLZShfIbZjx51IC9SwPw9q5reP3ffaB0EwGlAHPPdWze04Htq0Iw/bWb2DvDG3MSWFrdykwfiGYIS7LqOL5jJcL+K0ZkhKsg2QnkTIwGADu1ScyvmkymbrVa7aXT6bhh9fXbIdpETI+WsO2aBX+5YcHYYMXg1EAQUNVlw75vLShrtqLBRDgw1xuBoh3NTWYIXRaAnRmUAhQKAY03zBjmLWDXqmDMeqsFwzQCUoIkzB6uRpS34naK4RgFl0xo6LFj2Vg3HsV7b8kEuLu7c+4DsHV2dhq4ETc2NnLlDwqSiwH9jtD/RKQEnQQsKTbC2j/Ys9wy2TC10ADJYsWykUqU5nggNiwenv5J2JWXDkmKBIRwQIyEQopBwUv3wdsvDcn6GFx8MwTzMz1hNFjw4O5O2ds40xCLHX1GG1afNCDCU8SoIIknkK0G2eMFBwfzuaOjo8VsNts5KVVVVZV6vX5oXFwc90Q3DXZoHInJykQlVldY8MIXt5A/hold5pRolxlc22GHymLGrXYrwqovQu3jB8nvHkiePhDc1GD+mCxG2PqaYelugrGrBzVNFnzdbOMc1jHtHKA6jM9zDxs4DvkPaqFgRmcntPXKBAwdOhROnLkxs5+KioqKKVOmPJaSksLT6NJWO95MJlzrJ9wfIKBaL+K/vrHy2LApXQWFCDCzPvuIO9ZfNuPN5kDo+nTo62iFtr8B/m4N8JQESKKcXTMG91gIbRYBJo0fvPwiuCuNxtc4M0ML0UEAy9TnFxmxt9KM55LckOqn4JoQoBVxqVk21REjRvC5vLy8wkVAcXFx8cqVK1l4xvr163Gpi2A12xEiAY0mYIFeAbID+ZVWXGi1IT9diTRfEX4ikBUqojxwCD/0OwwLfX19fLDQz9wsc5VarRZqtVoOjgC++eYbtBz6GlrGc4uAU41WLD1nwqV2OxYkKJETp+TIs3TeSxDwVYssAeZynTg7zZH5cVVnZ2eX3W539/Hx4R/enixibqSIqwaCkRcWBBS12vG7Kjt6rMAYPwEdZsBDCURMnM5KMK5DEAuSDGGW8xw5coS7PZYmMPEzKefn5+PcuXOcmDCNgAB3ARXtdvi5Aa8kqzAuWHIZc4KvAp/UWPDsaROPNyx2SJJkCwoK8mtra+vmEjAajeajR48ezMzMnM2Okvv27cP739kxLxSIVwNXDICZCJN8gC/9BZzsEvDIZF+MDlfh8AUDPjxzBlu2bOFIMsTYqK2t5URMnTqVH8q9vLxw/fp1/p7YUY66D4Yg2FvCsXIDNh5sg9BuxMKhSozzF+WzgyAgykOAJxG2XOVhCllZWVCpVCyAnmTI89jl9KnbWQ0DwPz582Ud6wGKWonnIdyy7MC+m3acNylwfn0U1jzsDaHfhqXp7jyrZHnRzp07eaLGCFm+fDneeecdzvVDhw7htdde44Hy9KkifPhsIIKUBMlux6MjPXDqNT12vRCKTVVWHKy1ysZgtcMDhNMNFlxok13ovHnz+Lxz584/uGLXwMBQXl5ekpqaOnrUqFG4cOECUjyAI2kC6kwCGk2EOZcIxeuikMFiQo8FnS39GLetFd90Elc7xh1nms3S3pKSEk4cy2DHjx+PpKQkJA6Px5J7dXgsSYMJw7WAm0I+t6pEXKjtx32rapCfokCClwgvlYDcUgsudhLGjh3LJVtfX/9tbGzsULOZpbx3QGZm5kPssPD555+7Dhkv6UElY0SaFQzKGqmTDyxvR1DpfD96aZQ7/TJOSaNHj6aysjLau3cv3bx5884eALW0tNC+ffuovr6eQkNDKT1YQfVL/OjIk75EvwslejeC6H09PwC98JA3jfcDlUyQ6JWhXP58nD59mu81d+7cOfgxOHPmzHH2YlZWlnxKEkDbfyGQjwQ6/kII0cZworXBREt9afdEuaZZUFDAy+3Hjx+nNWvW8F5Bbm4ur2I3NDQMIuaTTz4hrVKgADXoxtOeRMt8iVYFEP0mmOi3oXR5RTD/5s5kgdxEGflZs2bxtUxDWLozEL5X2UlISIgpKyv7qru7W5ecnIyWlhZ4SYCRgJ71YVAbLbhea8LSk71QEqHWJ4HFEW477DQXHx/PjXbkyJE89WVebdmyZbh27RpXM4ZAc3MzdIIFLyVIuNxN+GCiOzRaiauTVSVC/dtW6BQAO9uEhITwc4q3t3f/2LFj08rKyq7ip2DBggU5jOLi4mISRVmMPu4CNS0LIPq1D9FcHa1PVPD7Z8+epZMnT/LqdWdnJ3333Xf0xz/+kYma5s2bx++xFhPrlzmhsbHR1Rh5Y5hAlCURZbsRPamh5lwdKR2cVygUvPvDYMWKFc/hH4GPP/54F1u4detWEgS5wxLnLVLNTA2ZZqgo1Qv09NNP881bW1tp9+7dlJeXR9nZ2XTo0CEXsgcOHOAqxYB1YtatW8cP8klJSTKSAmhTPIgeEan2fpGG6G4XCbZs2cLXHT16dP+dqvOTwMoWx44d2882YBx1SsJTAo3zATdcVsX4IXByu6mpiXOf1ftffPFFjviYMWNo4cKFfMaAikZmIMhLus15xhAGzCY1Go18IP5HQa1WK0+cOHHAyUnWfOAll8REam9v/0HkB3I+PDycPDw8KCIigqZOnUrLly/nbdj169dTQIDc+MMdg7WunA2OkpKSIp1O5/5jOP6kXJjo9uzZsyM7O3sui3VssJSho6MDN2/e5H6enSHYNTNOlj6wKMzSBFZ1YGmFt7c3z4dYnGC5PDuK7tq163vfYsbPminh4eHYtm3bu4sXL15hNptdB66fBYwDtbW1VcxQWWGJdRaZBPz8/L7HPWYrPj4+FBgYyP19TEwM1/Xx48fTY489Rs888wzvHzMVGbjOz8+P6ztTPdbgmzt3bjbuFqxevXoZEycTKzNOp96zmTWv9Xr9D6rC3zNiYmJo8+bNrm4+a+Oydi7uJmzevHkD25xx5siRI/sWL16cN23atEnsv81ms7BGN3O3S5cupREjRpBSKZckf2iwZyNHjuQGzdyvTe7c24qKij6bMGECL1T9o/CTNiCKouDr6+vBWjs2G6u83obQ0NCAnJycX86YMWNGWlraWFEUJZY6M7tg5Y/e3l5uCx4eHjwgsZzIUROyV1RUnC8sLCzcvXt3QW1trVwr+VcQ8PeCv7+/Z0ZGRnpiYmKSXq/XBwcHB7u7u2sZA/r6+vpaW1tbamtray9fvny5tLT0fEtLi9yS/CfhvwEPv/IpB1dpMAAAAABJRU5ErkJggg==" }, "annotations": [] } @@ -1549,6 +1954,9 @@ }, { "$ref": "#/groups/9" + }, + { + "$ref": "#/groups/11" } ], "content_layer": "body", @@ -1644,7 +2052,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/9" + } }, { "row_span": 1, @@ -1659,7 +2070,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/9" + "$ref": "#/groups/11" } }, { @@ -1803,10 +2214,13 @@ }, "children": [ { - "$ref": "#/groups/10" + "$ref": "#/groups/12" }, { - "$ref": "#/groups/11" + "$ref": "#/groups/14" + }, + { + "$ref": "#/groups/16" } ], "content_layer": "body", @@ -1867,7 +2281,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/12" + } }, { "row_span": 1, @@ -1882,7 +2299,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" } }, { @@ -1898,7 +2315,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/11" + "$ref": "#/groups/16" } } ], @@ -1997,9 +2414,13 @@ { "self_ref": "#/tables/2", "parent": { - "$ref": "#/groups/10" + "$ref": "#/groups/14" }, - "children": [], + "children": [ + { + "$ref": "#/groups/15" + } + ], "content_layer": "body", "label": "table", "prov": [], @@ -2058,7 +2479,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/15" + } }, { "row_span": 1, @@ -2180,9 +2604,13 @@ { "self_ref": "#/tables/3", "parent": { - "$ref": "#/groups/11" + "$ref": "#/groups/16" }, - "children": [], + "children": [ + { + "$ref": "#/groups/17" + } + ], "content_layer": "body", "label": "table", "prov": [], @@ -2241,7 +2669,10 @@ "column_header": false, "row_header": false, "row_section": false, - "fillable": false + "fillable": false, + "ref": { + "$ref": "#/groups/17" + } }, { "row_span": 1, @@ -2367,10 +2798,10 @@ }, "children": [ { - "$ref": "#/groups/13" + "$ref": "#/groups/19" }, { - "$ref": "#/groups/14" + "$ref": "#/groups/20" } ], "content_layer": "body", @@ -2433,7 +2864,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/13" + "$ref": "#/groups/19" } }, { @@ -2449,7 +2880,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/14" + "$ref": "#/groups/20" } }, { @@ -2565,10 +2996,10 @@ }, "children": [ { - "$ref": "#/groups/15" + "$ref": "#/groups/21" }, { - "$ref": "#/groups/17" + "$ref": "#/groups/23" } ], "content_layer": "body", @@ -2592,7 +3023,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/15" + "$ref": "#/groups/21" } }, { @@ -2608,7 +3039,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/17" + "$ref": "#/groups/23" } } ], @@ -2657,10 +3088,10 @@ }, "children": [ { - "$ref": "#/groups/19" + "$ref": "#/groups/25" }, { - "$ref": "#/groups/21" + "$ref": "#/groups/27" } ], "content_layer": "body", @@ -2684,7 +3115,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/19" + "$ref": "#/groups/25" } }, { @@ -2700,7 +3131,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/21" + "$ref": "#/groups/27" } } ], @@ -2749,16 +3180,16 @@ }, "children": [ { - "$ref": "#/groups/23" + "$ref": "#/groups/29" }, { - "$ref": "#/groups/25" + "$ref": "#/groups/31" }, { - "$ref": "#/groups/27" + "$ref": "#/groups/33" }, { - "$ref": "#/groups/29" + "$ref": "#/groups/35" } ], "content_layer": "body", @@ -2782,7 +3213,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/23" + "$ref": "#/groups/29" } }, { @@ -2798,7 +3229,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/25" + "$ref": "#/groups/31" } }, { @@ -2814,7 +3245,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/27" + "$ref": "#/groups/33" } }, { @@ -2830,7 +3261,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/29" + "$ref": "#/groups/35" } } ], @@ -2905,7 +3336,7 @@ }, "children": [ { - "$ref": "#/groups/31" + "$ref": "#/groups/37" } ], "content_layer": "body", @@ -2929,7 +3360,7 @@ "row_section": false, "fillable": false, "ref": { - "$ref": "#/groups/31" + "$ref": "#/groups/37" } }, { diff --git a/tests/data/odf/groundtruth/text_document_03.odt.md b/tests/data/odf/groundtruth/text_document_03.odt.md index fc1374f42a..0c99b38008 100644 --- a/tests/data/odf/groundtruth/text_document_03.odt.md +++ b/tests/data/odf/groundtruth/text_document_03.odt.md @@ -3,7 +3,7 @@ | Column A | Column B | | - | - | | This is a list: - A First - A Second - A Third | This is a formatted list: - B **First** - B *Second* - B Third | -| First Paragraph Second Paragraph Third paragraph before a numbered list 1. Number one 2. Number two 3. Number three | This is simple text with bold, strikethrough and italic formatting with x2 and H2O | +| First Paragraph Second Paragraph Third paragraph before a numbered list 1. Number one 2. Number two 3. Number three | This is simple text with **bold** , ~~strikethrough~~ and *italic* formatting with x 2 and H 2 O | | This is a paragraph This is another paragraph | | ### Table with nested table @@ -12,7 +12,7 @@ Before table | Column A | Column B | | - | - | -| Simple cell upper left | Simple cell with bold and italic text | +| Simple cell upper left | Simple cell with **bold** and *italic* text | | A B C Cell 1 Cell 2 Cell 3 | Rich cell A nested table A B C Cell 1 Cell 2 Cell 3 | After table with **bold** , underline , ~~strikethrough~~ , and *italic* formatting diff --git a/tests/test_backend_jats.py b/tests/test_backend_jats.py index fd7195f8c2..5b2a291256 100644 --- a/tests/test_backend_jats.py +++ b/tests/test_backend_jats.py @@ -62,6 +62,7 @@ GroupLabel, ListItem, PictureItem, + RichTableCell, TextItem, ) from docling_core.types.doc.document import Script @@ -1492,3 +1493,46 @@ def test_jats_empty_article_title_does_not_crash(): exported = doc.export_to_markdown() # Empty title is serialized as an H1 with no text. assert exported == "# " + + +def test_jats_table_cell_subscript_and_superscript(): + body = """ + + +

    Chemical Formulas

    + + + + + + +
    FormulaEnergy
    H2OE=mc2
    + + """ + doc = convert_jats_body(body) + assert len(doc.tables) == 1 + tbl = doc.tables[0] + sub_cell = tbl.data.table_cells[2] + sup_cell = tbl.data.table_cells[3] + + assert isinstance(sub_cell, RichTableCell) + group_sub = sub_cell.ref.resolve(doc) + inline_sub = group_sub.children[0].resolve(doc) + runs_sub = [c.resolve(doc) for c in inline_sub.children] + assert len(runs_sub) == 3 + assert runs_sub[0].text == "H" + assert runs_sub[1].text == "2" + assert runs_sub[1].formatting is not None + assert runs_sub[1].formatting.script == Script.SUB + assert runs_sub[2].text == "O" + + assert isinstance(sup_cell, RichTableCell) + group_sup = sup_cell.ref.resolve(doc) + inline_sup = group_sup.children[0].resolve(doc) + runs_sup = [c.resolve(doc) for c in inline_sup.children] + assert len(runs_sup) == 2 + assert runs_sup[0].text == "E=mc" + assert runs_sup[1].text == "2" + assert runs_sup[1].formatting is not None + assert runs_sup[1].formatting.script == Script.SUPER diff --git a/tests/test_backend_msword.py b/tests/test_backend_msword.py index 5716833baf..acab7ab833 100644 --- a/tests/test_backend_msword.py +++ b/tests/test_backend_msword.py @@ -14,10 +14,13 @@ ContentLayer, DocItemLabel, GroupItem, + GroupLabel, ListGroup, ListItem, PictureClassificationLabel, PictureItem, + RichTableCell, + Script, TableItem, ) from docx import Document @@ -2378,3 +2381,41 @@ def test_footnote_body_text_is_not_dropped_outside_plain_paragraphs( if item.label == DocItemLabel.FOOTNOTE ] assert expected in footnote_items + + +def test_table_cell_with_subscript_and_superscript(tmp_path: Path): + doc = Document() + table = doc.add_table(rows=1, cols=2) + cell0 = table.cell(0, 0) + cell0.paragraphs[0].text = "Water" + + cell1 = table.cell(0, 1) + p = cell1.paragraphs[0] + p.text = "" + p.add_run("H") + r2 = p.add_run("2") + r2.font.subscript = True + p.add_run("O") + + docx_path = tmp_path / "table_script.docx" + doc.save(docx_path) + + converter = DocumentConverter(allowed_formats=[InputFormat.DOCX]) + res = converter.convert(docx_path) + res_doc = res.document + + assert len(res_doc.tables) == 1 + tbl = res_doc.tables[0] + cell = tbl.data.table_cells[1] + assert isinstance(cell, RichTableCell) + group = cell.ref.resolve(res_doc) + assert group.label == GroupLabel.UNSPECIFIED + inline_group = group.children[0].resolve(res_doc) + assert inline_group.label == GroupLabel.INLINE + runs = [c.resolve(res_doc) for c in inline_group.children] + assert len(runs) == 3 + assert runs[0].text == "H" + assert runs[1].text == "2" + assert runs[1].formatting is not None + assert runs[1].formatting.script == Script.SUB + assert runs[2].text == "O" diff --git a/tests/test_backend_opendocument.py b/tests/test_backend_opendocument.py index 6561ccad83..b978696573 100644 --- a/tests/test_backend_opendocument.py +++ b/tests/test_backend_opendocument.py @@ -1943,3 +1943,55 @@ def test_odp_hidden_slide_goes_to_invisible_layer(tmp_path: Path): ] assert document.export_to_markdown() == "# Visible slide\n\nPresented text" assert hidden_texts == ["Hidden slide", "Backup text"] + + +def test_odt_table_cell_subscript_and_superscript(tmp_path: Path): + from odfdo import Cell, Paragraph, Row, Span, Style, Table + + doc = OdfDocument("text") + body = doc.body + body.clear() + + sub_style = Style("text", name="sub_style") + sub_style.set_properties(area="text", **{"style:text-position": "sub 58%"}) + doc.insert_style(sub_style, automatic=True) + + table = Table("Table1") + row = Row() + + c0 = Cell() + c0.append(Paragraph("Water")) + row.append(c0) + + c1 = Cell() + p = Paragraph() + p.append("H") + p.append(Span("2", style="sub_style")) + p.append("O") + c1.append(p) + row.append(c1) + + table.append(row) + body.append(table) + path = tmp_path / "table_sub.odt" + doc.save(str(path)) + + converter = DocumentConverter(allowed_formats=[InputFormat.ODT]) + res_doc = converter.convert(path).document + + assert len(res_doc.tables) == 1 + tbl = res_doc.tables[0] + assert len(tbl.data.table_cells) == 2 + cell = tbl.data.table_cells[1] + assert isinstance(cell, RichTableCell) + group = cell.ref.resolve(res_doc) + # The cell's rich group contains the inline group + inline_group = group.children[0].resolve(res_doc) + assert inline_group.label == GroupLabel.INLINE + runs = [c.resolve(res_doc) for c in inline_group.children] + assert len(runs) == 3 + assert runs[0].text == "H" + assert runs[1].text == "2" + assert runs[1].formatting is not None + assert runs[1].formatting.script == Script.SUB + assert runs[2].text == "O"